Incidental Mutation 'R4026:Adgrg7'
ID313003
Institutional Source Beutler Lab
Gene Symbol Adgrg7
Ensembl Gene ENSMUSG00000022755
Gene Nameadhesion G protein-coupled receptor G7
SynonymsGpr128, 9130020O16Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56724609-56795855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56730298 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 684 (Y684N)
Ref Sequence ENSEMBL: ENSMUSP00000023437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023437]
Predicted Effect probably damaging
Transcript: ENSMUST00000023437
AA Change: Y684N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023437
Gene: ENSMUSG00000022755
AA Change: Y684N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
SCOP:d1edmb_ 52 76 1e-3 SMART
GPS 376 424 6.16e-8 SMART
Pfam:7tm_2 428 712 4.5e-40 PFAM
Meta Mutation Damage Score 0.7217 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight gain and increased frequency of peristalsis and slow wave potential in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Adgrg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Adgrg7 APN 16 56747919 critical splice donor site probably null
IGL03122:Adgrg7 APN 16 56770362 splice site probably benign
R0632:Adgrg7 UTSW 16 56742589 missense possibly damaging 0.89
R0673:Adgrg7 UTSW 16 56773486 missense possibly damaging 0.48
R1690:Adgrg7 UTSW 16 56795630 missense probably damaging 0.99
R2009:Adgrg7 UTSW 16 56761873 missense probably benign 0.08
R2017:Adgrg7 UTSW 16 56732806 missense probably benign 0.02
R2132:Adgrg7 UTSW 16 56767918 missense probably damaging 1.00
R2153:Adgrg7 UTSW 16 56752428 missense possibly damaging 0.75
R2229:Adgrg7 UTSW 16 56752403 missense probably benign
R2436:Adgrg7 UTSW 16 56761945 missense possibly damaging 0.78
R2878:Adgrg7 UTSW 16 56750454 missense probably benign 0.14
R2981:Adgrg7 UTSW 16 56750406 critical splice donor site probably null
R4014:Adgrg7 UTSW 16 56742288 missense probably damaging 1.00
R4023:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4024:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4551:Adgrg7 UTSW 16 56748012 missense probably damaging 1.00
R4834:Adgrg7 UTSW 16 56732869 missense probably damaging 1.00
R5041:Adgrg7 UTSW 16 56730348 missense probably benign 0.21
R5145:Adgrg7 UTSW 16 56742319 missense probably benign 0.04
R5377:Adgrg7 UTSW 16 56730306 missense possibly damaging 0.68
R5549:Adgrg7 UTSW 16 56750427 missense probably damaging 1.00
R5915:Adgrg7 UTSW 16 56730385 splice site probably null
R5957:Adgrg7 UTSW 16 56773427 missense probably damaging 0.96
R6146:Adgrg7 UTSW 16 56773466 missense probably benign 0.21
R6198:Adgrg7 UTSW 16 56777193 missense possibly damaging 0.64
R6233:Adgrg7 UTSW 16 56778642 missense possibly damaging 0.52
R6337:Adgrg7 UTSW 16 56752425 missense probably damaging 0.96
R6633:Adgrg7 UTSW 16 56730286 missense probably benign 0.05
R6693:Adgrg7 UTSW 16 56770224 missense probably damaging 0.97
R6812:Adgrg7 UTSW 16 56795798 start gained probably benign
R6841:Adgrg7 UTSW 16 56750424 missense probably damaging 1.00
R6868:Adgrg7 UTSW 16 56773476 missense probably benign
R7076:Adgrg7 UTSW 16 56742406 missense probably damaging 1.00
R7146:Adgrg7 UTSW 16 56730242 missense probably damaging 1.00
R7232:Adgrg7 UTSW 16 56777152 synonymous probably null
R7266:Adgrg7 UTSW 16 56770311 missense probably benign 0.00
R7376:Adgrg7 UTSW 16 56724979 missense probably damaging 1.00
R7390:Adgrg7 UTSW 16 56732844 missense probably damaging 0.98
R7401:Adgrg7 UTSW 16 56742418 missense probably benign 0.43
R7496:Adgrg7 UTSW 16 56732857 missense probably benign
R7540:Adgrg7 UTSW 16 56750429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTAAGCAATGGTCCTCAGG -3'
(R):5'- ACTTTCTTCCGAGGGTGATAGG -3'

Sequencing Primer
(F):5'- CAATGGTCCTCAGGGATTTTACCAG -3'
(R):5'- TCGATGGGCAGTTGAACATGC -3'
Posted On2015-04-30