Incidental Mutation 'R4027:Lct'
ID313006
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 040850-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4027 (G1)
Quality Score140
Status Validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128285181 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1912 (R1912C)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably benign
Transcript: ENSMUST00000073490
AA Change: R1912C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: R1912C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162067
Meta Mutation Damage Score 0.1045 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik A G 2: 35,380,396 F98L probably damaging Het
Adam26b T C 8: 43,520,372 N531S probably benign Het
Ahdc1 T C 4: 133,064,165 S906P possibly damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Ano10 A G 9: 122,252,928 probably benign Het
Atp4a T C 7: 30,724,952 probably null Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Carmil1 T A 13: 24,067,223 probably benign Het
Ccl2 A G 11: 82,037,059 R110G probably benign Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cog6 A C 3: 53,002,529 D267E possibly damaging Het
Cyp4f37 G T 17: 32,631,672 E366D probably benign Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dpep1 T C 8: 123,194,153 V24A probably benign Het
Eefsec T C 6: 88,376,250 I48V probably benign Het
Elmo2 G A 2: 165,294,249 Q195* probably null Het
Ephb3 A G 16: 21,221,697 D561G probably damaging Het
Erich2 C A 2: 70,512,790 probably benign Het
Gatm A G 2: 122,597,446 V362A probably damaging Het
Gdf10 A G 14: 33,932,615 M360V probably damaging Het
Gpr141 T C 13: 19,751,825 N260S probably benign Het
Hectd1 T A 12: 51,802,436 probably null Het
Insrr A G 3: 87,809,599 E682G probably benign Het
Itgax A G 7: 128,141,266 I742V possibly damaging Het
Kcnh1 T C 1: 192,276,699 V187A probably benign Het
Kdm6b G T 11: 69,406,268 S419R possibly damaging Het
Kmt2a A T 9: 44,836,693 probably benign Het
Krt10 A G 11: 99,386,193 probably benign Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Mast3 A G 8: 70,787,908 L279P probably damaging Het
Mfsd4b3 T C 10: 39,947,347 T306A probably benign Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mknk1 T A 4: 115,864,561 F101I probably damaging Het
Mlc1 T C 15: 88,966,494 I154V probably benign Het
Myo5b T C 18: 74,759,240 I1685T possibly damaging Het
Nacc2 T A 2: 26,060,336 M463L probably benign Het
Nek11 A C 9: 105,244,390 Y443* probably null Het
Nme4 T C 17: 26,094,222 probably null Het
Nova1 A G 12: 46,817,018 probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Parp10 A G 15: 76,241,154 probably null Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Plce1 T C 19: 38,524,265 S3P probably damaging Het
Pnldc1 T C 17: 12,890,779 D400G probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Prmt6 A G 3: 110,249,941 I344T probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Ranbp17 C T 11: 33,500,718 R73Q possibly damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Tecpr1 C A 5: 144,206,259 A735S probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Vldlr A G 19: 27,238,313 T237A probably benign Het
Vmn1r74 C A 7: 11,846,971 T66K probably damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zmym1 C T 4: 127,049,879 V239I probably benign Het
Zmym5 T A 14: 56,797,811 T267S probably benign Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
R7577:Lct UTSW 1 128300732 missense probably damaging 0.99
R7626:Lct UTSW 1 128285195 missense probably damaging 1.00
R7737:Lct UTSW 1 128298693 missense probably benign 0.12
R7901:Lct UTSW 1 128288985 missense probably benign 0.44
R7984:Lct UTSW 1 128288985 missense probably benign 0.44
R8033:Lct UTSW 1 128285259 missense not run
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Z1176:Lct UTSW 1 128287611 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAATTACCTCCAGCGG -3'
(R):5'- AGGACTTTCTCAGAGCAGGC -3'

Sequencing Primer
(F):5'- TTACCTCCAGCGGTGCATAAAG -3'
(R):5'- CTAACAGTGCTAGAGCCTGAGC -3'
Posted On2015-04-30