Mutagenetix > Incidental Mutations

Incidental Mutation 'R4027:Cog6'

313016

Institutional Source

Beutler Lab

Gene Symbol

Cog6

Ensembl Gene

ENSMUSG00000027742

Gene Name

component of oligomeric golgi complex 6

Synonyms

MMRRC Submission

040850-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52981875-53017237 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53002529 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 267 (D267E)

Ref Sequence

ENSEMBL: ENSMUSP00000141339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036665
AA Change: D267E

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: D267E

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
COG6	55	656	N/A	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192788

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193432
AA Change: D267E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: D267E

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
COG6	55	625	5e-289	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195183

SMART Domains

Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
Pfam:COG6	39	174	5.5e-32	PFAM

Meta Mutation Damage Score

0.2853

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	A	G	2: 35,380,396	F98L	probably damaging	Het
Adam26b	T	C	8: 43,520,372	N531S	probably benign	Het
Ahdc1	T	C	4: 133,064,165	S906P	possibly damaging	Het
Ank	A	G	15: 27,544,257	N35D	probably damaging	Het
Ano10	A	G	9: 122,252,928		probably benign	Het
Atp4a	T	C	7: 30,724,952		probably null	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Carmil1	T	A	13: 24,067,223		probably benign	Het
Ccl2	A	G	11: 82,037,059	R110G	probably benign	Het
Cntnap2	C	A	6: 46,856,128	F758L	probably benign	Het
Cyp4f37	G	T	17: 32,631,672	E366D	probably benign	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Dpep1	T	C	8: 123,194,153	V24A	probably benign	Het
Eefsec	T	C	6: 88,376,250	I48V	probably benign	Het
Elmo2	G	A	2: 165,294,249	Q195*	probably null	Het
Ephb3	A	G	16: 21,221,697	D561G	probably damaging	Het
Erich2	C	A	2: 70,512,790		probably benign	Het
Gatm	A	G	2: 122,597,446	V362A	probably damaging	Het
Gdf10	A	G	14: 33,932,615	M360V	probably damaging	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Hectd1	T	A	12: 51,802,436		probably null	Het
Insrr	A	G	3: 87,809,599	E682G	probably benign	Het
Itgax	A	G	7: 128,141,266	I742V	possibly damaging	Het
Kcnh1	T	C	1: 192,276,699	V187A	probably benign	Het
Kdm6b	G	T	11: 69,406,268	S419R	possibly damaging	Het
Kmt2a	A	T	9: 44,836,693		probably benign	Het
Krt10	A	G	11: 99,386,193		probably benign	Het
Lct	G	A	1: 128,285,181	R1912C	probably benign	Het
Lefty1	T	C	1: 180,937,781	S305P	probably benign	Het
Mast3	A	G	8: 70,787,908	L279P	probably damaging	Het
Mfsd4b3	T	C	10: 39,947,347	T306A	probably benign	Het
Mgam	G	A	6: 40,754,902	R1351Q	probably damaging	Het
Mknk1	T	A	4: 115,864,561	F101I	probably damaging	Het
Mlc1	T	C	15: 88,966,494	I154V	probably benign	Het
Myo5b	T	C	18: 74,759,240	I1685T	possibly damaging	Het
Nacc2	T	A	2: 26,060,336	M463L	probably benign	Het
Nek11	A	C	9: 105,244,390	Y443*	probably null	Het
Nme4	T	C	17: 26,094,222		probably null	Het
Nova1	A	G	12: 46,817,018		probably benign	Het
Olfr651	A	T	7: 104,553,323	I135F	possibly damaging	Het
Parp10	A	G	15: 76,241,154		probably null	Het
Pkd1l3	T	A	8: 109,623,971	S483T	possibly damaging	Het
Plce1	T	C	19: 38,524,265	S3P	probably damaging	Het
Pnldc1	T	C	17: 12,890,779	D400G	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Prmt6	A	G	3: 110,249,941	I344T	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Ranbp17	C	T	11: 33,500,718	R73Q	possibly damaging	Het
Rcn1	G	T	2: 105,399,050	Y52*	probably null	Het
Reck	T	C	4: 43,922,931	I402T	probably damaging	Het
Tecpr1	C	A	5: 144,206,259	A735S	probably benign	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ube4a	G	A	9: 44,949,900		probably benign	Het
Vldlr	A	G	19: 27,238,313	T237A	probably benign	Het
Vmn1r74	C	A	7: 11,846,971	T66K	probably damaging	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Zmym1	C	T	4: 127,049,879	V239I	probably benign	Het
Zmym5	T	A	14: 56,797,811	T267S	probably benign	Het

Other mutations in Cog6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01922:Cog6	APN	3	52986425	missense	probably benign	0.03
IGL01946:Cog6	APN	3	53002404	intron	probably benign
IGL02122:Cog6	APN	3	52998342	missense	probably benign	0.04
IGL02589:Cog6	APN	3	53007270	missense	probably damaging	1.00
IGL02819:Cog6	APN	3	53009545	missense	probably damaging	0.98
R0045:Cog6	UTSW	3	52992750	splice site	probably null
R0045:Cog6	UTSW	3	52992750	splice site	probably null
R0086:Cog6	UTSW	3	52993570	missense	probably damaging	0.98
R0545:Cog6	UTSW	3	52996075	missense	probably damaging	1.00
R0707:Cog6	UTSW	3	53013862	missense	possibly damaging	0.71
R0718:Cog6	UTSW	3	53010629	missense	probably benign	0.35
R1169:Cog6	UTSW	3	53013844	missense	probably benign	0.30
R1451:Cog6	UTSW	3	53009113	missense	possibly damaging	0.78
R1891:Cog6	UTSW	3	52983180	missense	probably benign
R2249:Cog6	UTSW	3	53000479	critical splice donor site	probably null
R2264:Cog6	UTSW	3	52992911	nonsense	probably null
R3745:Cog6	UTSW	3	52992819	missense	probably benign	0.05
R4230:Cog6	UTSW	3	52992808	missense	probably benign	0.13
R4400:Cog6	UTSW	3	53012941	missense	probably benign	0.11
R4551:Cog6	UTSW	3	52998320	missense	probably damaging	1.00
R4866:Cog6	UTSW	3	53010598	missense	probably benign	0.10
R5326:Cog6	UTSW	3	53013816	missense	probably null	0.12
R6169:Cog6	UTSW	3	53007301	missense	probably benign	0.03
R6273:Cog6	UTSW	3	52996052	missense	probably damaging	1.00
R7169:Cog6	UTSW	3	52989966	missense	possibly damaging	0.94
R7199:Cog6	UTSW	3	52983189	missense	probably benign	0.21
R7243:Cog6	UTSW	3	53002315	missense	probably damaging	1.00
R7299:Cog6	UTSW	3	53002507	missense	probably benign	0.01
R8254:Cog6	UTSW	3	52993517	missense	probably benign
Z1177:Cog6	UTSW	3	53013864	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTAGTAAAGACGCTCCAGGGG -3'
(R):5'- TGCTCTTGGTCCAAAGCATTCC -3'

Sequencing Primer
(F):5'- GAAAGAGTCTAATCCTCTCCTAGGG -3'
(R):5'- GGTCCAAAGCATTCCTTCTTTGAAG -3'

Posted On

2015-04-30