Incidental Mutation 'R4027:Dcun1d4'
ID313025
Institutional Source Beutler Lab
Gene Symbol Dcun1d4
Ensembl Gene ENSMUSG00000051674
Gene NameDCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Synonyms
MMRRC Submission 040850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4027 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73481000-73560794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73534637 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000119983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063882] [ENSMUST00000087181] [ENSMUST00000113558] [ENSMUST00000133137] [ENSMUST00000134092] [ENSMUST00000136268] [ENSMUST00000145645]
Predicted Effect probably benign
Transcript: ENSMUST00000063882
AA Change: D149G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067616
Gene: ENSMUSG00000051674
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 173 287 3.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087181
AA Change: D163G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084427
Gene: ENSMUSG00000051674
AA Change: D163G

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:Cullin_binding 189 300 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113558
AA Change: D149G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109187
Gene: ENSMUSG00000051674
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 203 252 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130087
SMART Domains Protein: ENSMUSP00000118392
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:3KEV|A 44 109 3e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133137
SMART Domains Protein: ENSMUSP00000120055
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134092
SMART Domains Protein: ENSMUSP00000118710
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136268
AA Change: D89G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119983
Gene: ENSMUSG00000051674
AA Change: D89G

DomainStartEndE-ValueType
PDB:4GBA|B 42 104 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000145645
AA Change: D89G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122689
Gene: ENSMUSG00000051674
AA Change: D89G

DomainStartEndE-ValueType
PDB:4GBA|B 42 101 1e-7 PDB
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik A G 2: 35,380,396 F98L probably damaging Het
Adam26b T C 8: 43,520,372 N531S probably benign Het
Ahdc1 T C 4: 133,064,165 S906P possibly damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Ano10 A G 9: 122,252,928 probably benign Het
Atp4a T C 7: 30,724,952 probably null Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Carmil1 T A 13: 24,067,223 probably benign Het
Ccl2 A G 11: 82,037,059 R110G probably benign Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cog6 A C 3: 53,002,529 D267E possibly damaging Het
Cyp4f37 G T 17: 32,631,672 E366D probably benign Het
Dpep1 T C 8: 123,194,153 V24A probably benign Het
Eefsec T C 6: 88,376,250 I48V probably benign Het
Elmo2 G A 2: 165,294,249 Q195* probably null Het
Ephb3 A G 16: 21,221,697 D561G probably damaging Het
Erich2 C A 2: 70,512,790 probably benign Het
Gatm A G 2: 122,597,446 V362A probably damaging Het
Gdf10 A G 14: 33,932,615 M360V probably damaging Het
Gpr141 T C 13: 19,751,825 N260S probably benign Het
Hectd1 T A 12: 51,802,436 probably null Het
Insrr A G 3: 87,809,599 E682G probably benign Het
Itgax A G 7: 128,141,266 I742V possibly damaging Het
Kcnh1 T C 1: 192,276,699 V187A probably benign Het
Kdm6b G T 11: 69,406,268 S419R possibly damaging Het
Kmt2a A T 9: 44,836,693 probably benign Het
Krt10 A G 11: 99,386,193 probably benign Het
Lct G A 1: 128,285,181 R1912C probably benign Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Mast3 A G 8: 70,787,908 L279P probably damaging Het
Mfsd4b3 T C 10: 39,947,347 T306A probably benign Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mknk1 T A 4: 115,864,561 F101I probably damaging Het
Mlc1 T C 15: 88,966,494 I154V probably benign Het
Myo5b T C 18: 74,759,240 I1685T possibly damaging Het
Nacc2 T A 2: 26,060,336 M463L probably benign Het
Nek11 A C 9: 105,244,390 Y443* probably null Het
Nme4 T C 17: 26,094,222 probably null Het
Nova1 A G 12: 46,817,018 probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Parp10 A G 15: 76,241,154 probably null Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Plce1 T C 19: 38,524,265 S3P probably damaging Het
Pnldc1 T C 17: 12,890,779 D400G probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Prmt6 A G 3: 110,249,941 I344T probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Ranbp17 C T 11: 33,500,718 R73Q possibly damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Tecpr1 C A 5: 144,206,259 A735S probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Vldlr A G 19: 27,238,313 T237A probably benign Het
Vmn1r74 C A 7: 11,846,971 T66K probably damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zmym1 C T 4: 127,049,879 V239I probably benign Het
Zmym5 T A 14: 56,797,811 T267S probably benign Het
Other mutations in Dcun1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Dcun1d4 APN 5 73481201 splice site probably benign
IGL02345:Dcun1d4 APN 5 73511152 missense probably damaging 0.99
IGL03264:Dcun1d4 APN 5 73520229 missense probably benign 0.00
PIT4402001:Dcun1d4 UTSW 5 73510933 missense probably benign 0.09
R1184:Dcun1d4 UTSW 5 73511112 splice site probably benign
R2266:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2267:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2268:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2269:Dcun1d4 UTSW 5 73481275 splice site probably benign
R4029:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4031:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4788:Dcun1d4 UTSW 5 73534628 missense probably damaging 1.00
R4961:Dcun1d4 UTSW 5 73544120 nonsense probably null
R5245:Dcun1d4 UTSW 5 73557314 missense probably benign 0.11
R5284:Dcun1d4 UTSW 5 73522682 unclassified probably null
R5457:Dcun1d4 UTSW 5 73531565 missense probably damaging 1.00
R5728:Dcun1d4 UTSW 5 73520148 missense possibly damaging 0.61
R6469:Dcun1d4 UTSW 5 73534614 missense probably damaging 0.99
R6813:Dcun1d4 UTSW 5 73520957 missense possibly damaging 0.90
R7165:Dcun1d4 UTSW 5 73491195 splice site probably null
R7439:Dcun1d4 UTSW 5 73491536 critical splice donor site probably null
X0063:Dcun1d4 UTSW 5 73555438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAAACCCAGACTCACTCAG -3'
(R):5'- AAGGGAGGCTTGCTACACTACC -3'

Sequencing Primer
(F):5'- AGACTCACTCAGTTTTGAAGCC -3'
(R):5'- ATGTCCTAAGTTCCCAGGAGC -3'
Posted On2015-04-30