Incidental Mutation 'R4027:Mast3'
ID 313038
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 040850-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene? Non essential (E-score: 0.000) question?
Stock # R4027 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 70778117-70805054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70787908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 279 (L279P)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: L295P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: L295P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: L279P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.9680 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (60/62)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik A G 2: 35,380,396 F98L probably damaging Het
Adam26b T C 8: 43,520,372 N531S probably benign Het
Ahdc1 T C 4: 133,064,165 S906P possibly damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Ano10 A G 9: 122,252,928 probably benign Het
Atp4a T C 7: 30,724,952 probably null Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Carmil1 T A 13: 24,067,223 probably benign Het
Ccl2 A G 11: 82,037,059 R110G probably benign Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cog6 A C 3: 53,002,529 D267E possibly damaging Het
Cyp4f37 G T 17: 32,631,672 E366D probably benign Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dpep1 T C 8: 123,194,153 V24A probably benign Het
Eefsec T C 6: 88,376,250 I48V probably benign Het
Elmo2 G A 2: 165,294,249 Q195* probably null Het
Ephb3 A G 16: 21,221,697 D561G probably damaging Het
Erich2 C A 2: 70,512,790 probably benign Het
Gatm A G 2: 122,597,446 V362A probably damaging Het
Gdf10 A G 14: 33,932,615 M360V probably damaging Het
Gpr141 T C 13: 19,751,825 N260S probably benign Het
Hectd1 T A 12: 51,802,436 probably null Het
Insrr A G 3: 87,809,599 E682G probably benign Het
Itgax A G 7: 128,141,266 I742V possibly damaging Het
Kcnh1 T C 1: 192,276,699 V187A probably benign Het
Kdm6b G T 11: 69,406,268 S419R possibly damaging Het
Kmt2a A T 9: 44,836,693 probably benign Het
Krt10 A G 11: 99,386,193 probably benign Het
Lct G A 1: 128,285,181 R1912C probably benign Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Mfsd4b3 T C 10: 39,947,347 T306A probably benign Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mknk1 T A 4: 115,864,561 F101I probably damaging Het
Mlc1 T C 15: 88,966,494 I154V probably benign Het
Myo5b T C 18: 74,759,240 I1685T possibly damaging Het
Nacc2 T A 2: 26,060,336 M463L probably benign Het
Nek11 A C 9: 105,244,390 Y443* probably null Het
Nme4 T C 17: 26,094,222 probably null Het
Nova1 A G 12: 46,817,018 probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Parp10 A G 15: 76,241,154 probably null Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Plce1 T C 19: 38,524,265 S3P probably damaging Het
Pnldc1 T C 17: 12,890,779 D400G probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Prmt6 A G 3: 110,249,941 I344T probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Ranbp17 C T 11: 33,500,718 R73Q possibly damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Tecpr1 C A 5: 144,206,259 A735S probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Vldlr A G 19: 27,238,313 T237A probably benign Het
Vmn1r74 C A 7: 11,846,971 T66K probably damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zmym1 C T 4: 127,049,879 V239I probably benign Het
Zmym5 T A 14: 56,797,811 T267S probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8891:Mast3 UTSW 8 70781157 missense probably damaging 1.00
R8930:Mast3 UTSW 8 70781733 splice site probably benign
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
R9085:Mast3 UTSW 8 70796717 missense unknown
R9087:Mast3 UTSW 8 70789686 missense possibly damaging 0.93
R9148:Mast3 UTSW 8 70780447 missense probably damaging 0.98
R9364:Mast3 UTSW 8 70786182 missense probably damaging 1.00
R9779:Mast3 UTSW 8 70785483 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCAGTCTTCACGCCCTG -3'
(R):5'- TTCCTGGAGATGCAGGACAAG -3'

Sequencing Primer
(F):5'- TCACGCCCTGGTCCTCG -3'
(R):5'- CAAGCTGGAGAGGCTGTTGC -3'
Posted On 2015-04-30