Mutagenetix > Incidental Mutations

Incidental Mutation 'R4027:Mast3'

313038

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

040850-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70787908 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 279 (L279P)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: L295P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: L295P

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: L279P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Meta Mutation Damage Score

0.9680

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

97% (60/62)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	A	G	2: 35,380,396	F98L	probably damaging	Het
Adam26b	T	C	8: 43,520,372	N531S	probably benign	Het
Ahdc1	T	C	4: 133,064,165	S906P	possibly damaging	Het
Ank	A	G	15: 27,544,257	N35D	probably damaging	Het
Ano10	A	G	9: 122,252,928		probably benign	Het
Atp4a	T	C	7: 30,724,952		probably null	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Carmil1	T	A	13: 24,067,223		probably benign	Het
Ccl2	A	G	11: 82,037,059	R110G	probably benign	Het
Cntnap2	C	A	6: 46,856,128	F758L	probably benign	Het
Cog6	A	C	3: 53,002,529	D267E	possibly damaging	Het
Cyp4f37	G	T	17: 32,631,672	E366D	probably benign	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Dpep1	T	C	8: 123,194,153	V24A	probably benign	Het
Eefsec	T	C	6: 88,376,250	I48V	probably benign	Het
Elmo2	G	A	2: 165,294,249	Q195*	probably null	Het
Ephb3	A	G	16: 21,221,697	D561G	probably damaging	Het
Erich2	C	A	2: 70,512,790		probably benign	Het
Gatm	A	G	2: 122,597,446	V362A	probably damaging	Het
Gdf10	A	G	14: 33,932,615	M360V	probably damaging	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Hectd1	T	A	12: 51,802,436		probably null	Het
Insrr	A	G	3: 87,809,599	E682G	probably benign	Het
Itgax	A	G	7: 128,141,266	I742V	possibly damaging	Het
Kcnh1	T	C	1: 192,276,699	V187A	probably benign	Het
Kdm6b	G	T	11: 69,406,268	S419R	possibly damaging	Het
Kmt2a	A	T	9: 44,836,693		probably benign	Het
Krt10	A	G	11: 99,386,193		probably benign	Het
Lct	G	A	1: 128,285,181	R1912C	probably benign	Het
Lefty1	T	C	1: 180,937,781	S305P	probably benign	Het
Mfsd4b3	T	C	10: 39,947,347	T306A	probably benign	Het
Mgam	G	A	6: 40,754,902	R1351Q	probably damaging	Het
Mknk1	T	A	4: 115,864,561	F101I	probably damaging	Het
Mlc1	T	C	15: 88,966,494	I154V	probably benign	Het
Myo5b	T	C	18: 74,759,240	I1685T	possibly damaging	Het
Nacc2	T	A	2: 26,060,336	M463L	probably benign	Het
Nek11	A	C	9: 105,244,390	Y443*	probably null	Het
Nme4	T	C	17: 26,094,222		probably null	Het
Nova1	A	G	12: 46,817,018		probably benign	Het
Olfr651	A	T	7: 104,553,323	I135F	possibly damaging	Het
Parp10	A	G	15: 76,241,154		probably null	Het
Pkd1l3	T	A	8: 109,623,971	S483T	possibly damaging	Het
Plce1	T	C	19: 38,524,265	S3P	probably damaging	Het
Pnldc1	T	C	17: 12,890,779	D400G	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Prmt6	A	G	3: 110,249,941	I344T	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Ranbp17	C	T	11: 33,500,718	R73Q	possibly damaging	Het
Rcn1	G	T	2: 105,399,050	Y52*	probably null	Het
Reck	T	C	4: 43,922,931	I402T	probably damaging	Het
Tecpr1	C	A	5: 144,206,259	A735S	probably benign	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ube4a	G	A	9: 44,949,900		probably benign	Het
Vldlr	A	G	19: 27,238,313	T237A	probably benign	Het
Vmn1r74	C	A	7: 11,846,971	T66K	probably damaging	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Zmym1	C	T	4: 127,049,879	V239I	probably benign	Het
Zmym5	T	A	14: 56,797,811	T267S	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	unclassified	probably null
R1208:Mast3	UTSW	8	70788272	unclassified	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCAGTCTTCACGCCCTG -3'
(R):5'- TTCCTGGAGATGCAGGACAAG -3'

Sequencing Primer
(F):5'- TCACGCCCTGGTCCTCG -3'
(R):5'- CAAGCTGGAGAGGCTGTTGC -3'

Posted On

2015-04-30