Incidental Mutation 'R4027:Dpep1'
ID313040
Institutional Source Beutler Lab
Gene Symbol Dpep1
Ensembl Gene ENSMUSG00000019278
Gene Namedipeptidase 1 (renal)
SynonymsMBD
MMRRC Submission 040850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4027 (G1)
Quality Score173
Status Validated
Chromosome8
Chromosomal Location123186242-123201812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123194153 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 24 (V24A)
Ref Sequence ENSEMBL: ENSMUSP00000148823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019422] [ENSMUST00000127664] [ENSMUST00000212409] [ENSMUST00000212773]
Predicted Effect probably benign
Transcript: ENSMUST00000019422
AA Change: V24A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000019422
Gene: ENSMUSG00000019278
AA Change: V24A

DomainStartEndE-ValueType
Pfam:Peptidase_M19 25 352 4.1e-122 PFAM
low complexity region 398 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212409
AA Change: V24A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000212773
AA Change: V24A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for disruption of this gene ar phenotypically normal although defects have been noted in the conversion of leukotriene D4 to leukotrience E4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik A G 2: 35,380,396 F98L probably damaging Het
Adam26b T C 8: 43,520,372 N531S probably benign Het
Ahdc1 T C 4: 133,064,165 S906P possibly damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Ano10 A G 9: 122,252,928 probably benign Het
Atp4a T C 7: 30,724,952 probably null Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Carmil1 T A 13: 24,067,223 probably benign Het
Ccl2 A G 11: 82,037,059 R110G probably benign Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cog6 A C 3: 53,002,529 D267E possibly damaging Het
Cyp4f37 G T 17: 32,631,672 E366D probably benign Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Eefsec T C 6: 88,376,250 I48V probably benign Het
Elmo2 G A 2: 165,294,249 Q195* probably null Het
Ephb3 A G 16: 21,221,697 D561G probably damaging Het
Erich2 C A 2: 70,512,790 probably benign Het
Gatm A G 2: 122,597,446 V362A probably damaging Het
Gdf10 A G 14: 33,932,615 M360V probably damaging Het
Gpr141 T C 13: 19,751,825 N260S probably benign Het
Hectd1 T A 12: 51,802,436 probably null Het
Insrr A G 3: 87,809,599 E682G probably benign Het
Itgax A G 7: 128,141,266 I742V possibly damaging Het
Kcnh1 T C 1: 192,276,699 V187A probably benign Het
Kdm6b G T 11: 69,406,268 S419R possibly damaging Het
Kmt2a A T 9: 44,836,693 probably benign Het
Krt10 A G 11: 99,386,193 probably benign Het
Lct G A 1: 128,285,181 R1912C probably benign Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Mast3 A G 8: 70,787,908 L279P probably damaging Het
Mfsd4b3 T C 10: 39,947,347 T306A probably benign Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mknk1 T A 4: 115,864,561 F101I probably damaging Het
Mlc1 T C 15: 88,966,494 I154V probably benign Het
Myo5b T C 18: 74,759,240 I1685T possibly damaging Het
Nacc2 T A 2: 26,060,336 M463L probably benign Het
Nek11 A C 9: 105,244,390 Y443* probably null Het
Nme4 T C 17: 26,094,222 probably null Het
Nova1 A G 12: 46,817,018 probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Parp10 A G 15: 76,241,154 probably null Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Plce1 T C 19: 38,524,265 S3P probably damaging Het
Pnldc1 T C 17: 12,890,779 D400G probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Prmt6 A G 3: 110,249,941 I344T probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Ranbp17 C T 11: 33,500,718 R73Q possibly damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Tecpr1 C A 5: 144,206,259 A735S probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Vldlr A G 19: 27,238,313 T237A probably benign Het
Vmn1r74 C A 7: 11,846,971 T66K probably damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zmym1 C T 4: 127,049,879 V239I probably benign Het
Zmym5 T A 14: 56,797,811 T267S probably benign Het
Other mutations in Dpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Dpep1 APN 8 123199615 splice site probably benign
IGL02354:Dpep1 APN 8 123200218 missense probably benign
IGL02361:Dpep1 APN 8 123200218 missense probably benign
IGL02527:Dpep1 APN 8 123198748 missense probably damaging 1.00
IGL02723:Dpep1 APN 8 123194149 missense possibly damaging 0.95
R0190:Dpep1 UTSW 8 123200708 missense probably benign 0.21
R1348:Dpep1 UTSW 8 123199160 missense probably benign 0.02
R1719:Dpep1 UTSW 8 123200747 missense possibly damaging 0.67
R2060:Dpep1 UTSW 8 123200391 missense probably damaging 0.99
R2081:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R2279:Dpep1 UTSW 8 123194144 missense probably benign 0.04
R3931:Dpep1 UTSW 8 123198779 missense possibly damaging 0.73
R4836:Dpep1 UTSW 8 123200367 missense probably damaging 1.00
R5007:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R5149:Dpep1 UTSW 8 123200438 missense probably benign 0.01
R5268:Dpep1 UTSW 8 123194089 missense probably benign 0.12
R5774:Dpep1 UTSW 8 123199982 missense probably damaging 1.00
R6041:Dpep1 UTSW 8 123200655 missense probably damaging 0.99
R6335:Dpep1 UTSW 8 123200652 missense probably damaging 1.00
R7705:Dpep1 UTSW 8 123200721 missense possibly damaging 0.94
T0975:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
X0005:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGACTCCGTCTTAATTACCCG -3'
(R):5'- TGGGTCCTAAGATACTCCACTG -3'

Sequencing Primer
(F):5'- GTCTTAATTACCCGGACCAAAGG -3'
(R):5'- ATCTCGATAGGGGGTCAC -3'
Posted On2015-04-30