Mutagenetix > Incidental Mutations

Incidental Mutation 'R4027:Ube4a'

313042

Institutional Source

Beutler Lab

Gene Symbol

Ube4a

Ensembl Gene

ENSMUSG00000059890

Gene Name

ubiquitination factor E4A

Synonyms

9930123J21Rik, UFD2b, 4732444G18Rik

MMRRC Submission

040850-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44923127-44965600 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 44949900 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000125642] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213666] [ENSMUST00000213890] [ENSMUST00000214761]

Predicted Effect

probably benign
Transcript: ENSMUST00000117506

SMART Domains

Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	288	299	N/A	INTRINSIC
Pfam:Ufd2P_core	330	766	2.6e-101	PFAM
Pfam:Ufd2P_core	762	935	7.4e-61	PFAM
Ubox	953	1016	1.9e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117549

SMART Domains

Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	991	3.4e-155	PFAM
Ubox	1010	1073	1.9e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125642

Predicted Effect

probably benign
Transcript: ENSMUST00000138559

Predicted Effect

probably benign
Transcript: ENSMUST00000145657

Predicted Effect

probably benign
Transcript: ENSMUST00000154287

SMART Domains

Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	547	4.1e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213193

Predicted Effect

probably benign
Transcript: ENSMUST00000213666

Predicted Effect

probably benign
Transcript: ENSMUST00000213890

Predicted Effect

probably benign
Transcript: ENSMUST00000214761

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	A	G	2: 35,380,396	F98L	probably damaging	Het
Adam26b	T	C	8: 43,520,372	N531S	probably benign	Het
Ahdc1	T	C	4: 133,064,165	S906P	possibly damaging	Het
Ank	A	G	15: 27,544,257	N35D	probably damaging	Het
Ano10	A	G	9: 122,252,928		probably benign	Het
Atp4a	T	C	7: 30,724,952		probably null	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Carmil1	T	A	13: 24,067,223		probably benign	Het
Ccl2	A	G	11: 82,037,059	R110G	probably benign	Het
Cntnap2	C	A	6: 46,856,128	F758L	probably benign	Het
Cog6	A	C	3: 53,002,529	D267E	possibly damaging	Het
Cyp4f37	G	T	17: 32,631,672	E366D	probably benign	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Dpep1	T	C	8: 123,194,153	V24A	probably benign	Het
Eefsec	T	C	6: 88,376,250	I48V	probably benign	Het
Elmo2	G	A	2: 165,294,249	Q195*	probably null	Het
Ephb3	A	G	16: 21,221,697	D561G	probably damaging	Het
Erich2	C	A	2: 70,512,790		probably benign	Het
Gatm	A	G	2: 122,597,446	V362A	probably damaging	Het
Gdf10	A	G	14: 33,932,615	M360V	probably damaging	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Hectd1	T	A	12: 51,802,436		probably null	Het
Insrr	A	G	3: 87,809,599	E682G	probably benign	Het
Itgax	A	G	7: 128,141,266	I742V	possibly damaging	Het
Kcnh1	T	C	1: 192,276,699	V187A	probably benign	Het
Kdm6b	G	T	11: 69,406,268	S419R	possibly damaging	Het
Kmt2a	A	T	9: 44,836,693		probably benign	Het
Krt10	A	G	11: 99,386,193		probably benign	Het
Lct	G	A	1: 128,285,181	R1912C	probably benign	Het
Lefty1	T	C	1: 180,937,781	S305P	probably benign	Het
Mast3	A	G	8: 70,787,908	L279P	probably damaging	Het
Mfsd4b3	T	C	10: 39,947,347	T306A	probably benign	Het
Mgam	G	A	6: 40,754,902	R1351Q	probably damaging	Het
Mknk1	T	A	4: 115,864,561	F101I	probably damaging	Het
Mlc1	T	C	15: 88,966,494	I154V	probably benign	Het
Myo5b	T	C	18: 74,759,240	I1685T	possibly damaging	Het
Nacc2	T	A	2: 26,060,336	M463L	probably benign	Het
Nek11	A	C	9: 105,244,390	Y443*	probably null	Het
Nme4	T	C	17: 26,094,222		probably null	Het
Nova1	A	G	12: 46,817,018		probably benign	Het
Olfr651	A	T	7: 104,553,323	I135F	possibly damaging	Het
Parp10	A	G	15: 76,241,154		probably null	Het
Pkd1l3	T	A	8: 109,623,971	S483T	possibly damaging	Het
Plce1	T	C	19: 38,524,265	S3P	probably damaging	Het
Pnldc1	T	C	17: 12,890,779	D400G	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Prmt6	A	G	3: 110,249,941	I344T	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Ranbp17	C	T	11: 33,500,718	R73Q	possibly damaging	Het
Rcn1	G	T	2: 105,399,050	Y52*	probably null	Het
Reck	T	C	4: 43,922,931	I402T	probably damaging	Het
Tecpr1	C	A	5: 144,206,259	A735S	probably benign	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Vldlr	A	G	19: 27,238,313	T237A	probably benign	Het
Vmn1r74	C	A	7: 11,846,971	T66K	probably damaging	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Zmym1	C	T	4: 127,049,879	V239I	probably benign	Het
Zmym5	T	A	14: 56,797,811	T267S	probably benign	Het

Other mutations in Ube4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ube4a	APN	9	44948141	missense	probably damaging	1.00
IGL00857:Ube4a	APN	9	44932386	missense	probably damaging	1.00
IGL01067:Ube4a	APN	9	44944865	missense	probably damaging	0.96
White_way	UTSW	9	44949753	nonsense	probably null
R0243:Ube4a	UTSW	9	44946178	unclassified	probably benign
R0355:Ube4a	UTSW	9	44944801	splice site	probably benign
R0680:Ube4a	UTSW	9	44948060	missense	probably damaging	1.00
R0863:Ube4a	UTSW	9	44949816	missense	possibly damaging	0.55
R0909:Ube4a	UTSW	9	44939973	missense	probably damaging	0.97
R1597:Ube4a	UTSW	9	44929766	missense	possibly damaging	0.93
R1611:Ube4a	UTSW	9	44956737	intron	probably benign
R1871:Ube4a	UTSW	9	44944937	splice site	probably null
R2069:Ube4a	UTSW	9	44948099	missense	probably damaging	0.96
R2518:Ube4a	UTSW	9	44948137	missense	probably benign	0.29
R3079:Ube4a	UTSW	9	44960073	missense	probably damaging	1.00
R3404:Ube4a	UTSW	9	44929687	missense	probably damaging	1.00
R3726:Ube4a	UTSW	9	44933323	missense	probably damaging	0.97
R3758:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4029:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4111:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4113:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4238:Ube4a	UTSW	9	44939999	missense	probably damaging	1.00
R4365:Ube4a	UTSW	9	44960081	missense	probably damaging	1.00
R4471:Ube4a	UTSW	9	44946532	unclassified	probably benign
R4793:Ube4a	UTSW	9	44948822	missense	probably damaging	1.00
R5069:Ube4a	UTSW	9	44940089	missense	probably damaging	1.00
R5214:Ube4a	UTSW	9	44948868	missense	probably benign	0.22
R5225:Ube4a	UTSW	9	44939960	critical splice donor site	probably null
R5416:Ube4a	UTSW	9	44941178	missense	probably damaging	0.99
R5641:Ube4a	UTSW	9	44950881	missense	probably damaging	0.99
R5729:Ube4a	UTSW	9	44933329	missense	probably damaging	1.00
R5774:Ube4a	UTSW	9	44953097	missense	probably damaging	0.99
R5908:Ube4a	UTSW	9	44948024	critical splice donor site	probably null
R6191:Ube4a	UTSW	9	44949753	nonsense	probably null
R6752:Ube4a	UTSW	9	44925948	missense	probably damaging	1.00
R6886:Ube4a	UTSW	9	44948843	missense	probably damaging	0.96
R6911:Ube4a	UTSW	9	44942758	missense	probably damaging	1.00
R7417:Ube4a	UTSW	9	44956713	missense	probably benign	0.08
R7650:Ube4a	UTSW	9	44933436	missense	probably damaging	0.99
R7747:Ube4a	UTSW	9	44925973	missense	probably damaging	1.00
R7798:Ube4a	UTSW	9	44933331	missense	probably damaging	1.00
R7842:Ube4a	UTSW	9	44949727	splice site	probably null
R7853:Ube4a	UTSW	9	44953010	missense	probably benign	0.43
R8109:Ube4a	UTSW	9	44935483	missense	probably benign	0.00
R8223:Ube4a	UTSW	9	44960035	missense	possibly damaging	0.94
R8401:Ube4a	UTSW	9	44941229	missense	possibly damaging	0.84
X0025:Ube4a	UTSW	9	44942818	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TACTCACGGGCTCCCTGAATAG -3'
(R):5'- TGTCAGGAATTTTCAGTCCCC -3'

Sequencing Primer
(F):5'- GGCTCCCTGAATAGCTTCCAAC -3'
(R):5'- ATTTTATCCCAGCACTCAGGAGG -3'

Posted On

2015-04-30