Incidental Mutation 'R4027:Ccl2'
ID313049
Institutional Source Beutler Lab
Gene Symbol Ccl2
Ensembl Gene ENSMUSG00000035385
Gene Namechemokine (C-C motif) ligand 2
SynonymsSigje, SMC-CF, monocyte chemoattractant protein-1, MCP1, MCP-1, monocyte chemotactic protein, Scya2, HC11, MCAF
MMRRC Submission 040850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4027 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82035571-82037453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82037059 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 110 (R110G)
Ref Sequence ENSEMBL: ENSMUSP00000000193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000193] [ENSMUST00000171515]
Predicted Effect probably benign
Transcript: ENSMUST00000000193
AA Change: R110G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000193
Gene: ENSMUSG00000035385
AA Change: R110G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 90 4.63e-32 SMART
low complexity region 128 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124479
Predicted Effect probably benign
Transcript: ENSMUST00000171515
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene is one of several cytokine genes clustered on chromosome 11. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and memory T cells but not for neutrophils. The human ortholog has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, such as psoriasis, rheumatoid arthritis, and atherosclerosis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective macrophage recruitment, abnormal choroid morphology, photoreceptor degeneration, and altered response to injury, infection, alcohol, and a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik A G 2: 35,380,396 F98L probably damaging Het
Adam26b T C 8: 43,520,372 N531S probably benign Het
Ahdc1 T C 4: 133,064,165 S906P possibly damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Ano10 A G 9: 122,252,928 probably benign Het
Atp4a T C 7: 30,724,952 probably null Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Carmil1 T A 13: 24,067,223 probably benign Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cog6 A C 3: 53,002,529 D267E possibly damaging Het
Cyp4f37 G T 17: 32,631,672 E366D probably benign Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dpep1 T C 8: 123,194,153 V24A probably benign Het
Eefsec T C 6: 88,376,250 I48V probably benign Het
Elmo2 G A 2: 165,294,249 Q195* probably null Het
Ephb3 A G 16: 21,221,697 D561G probably damaging Het
Erich2 C A 2: 70,512,790 probably benign Het
Gatm A G 2: 122,597,446 V362A probably damaging Het
Gdf10 A G 14: 33,932,615 M360V probably damaging Het
Gpr141 T C 13: 19,751,825 N260S probably benign Het
Hectd1 T A 12: 51,802,436 probably null Het
Insrr A G 3: 87,809,599 E682G probably benign Het
Itgax A G 7: 128,141,266 I742V possibly damaging Het
Kcnh1 T C 1: 192,276,699 V187A probably benign Het
Kdm6b G T 11: 69,406,268 S419R possibly damaging Het
Kmt2a A T 9: 44,836,693 probably benign Het
Krt10 A G 11: 99,386,193 probably benign Het
Lct G A 1: 128,285,181 R1912C probably benign Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Mast3 A G 8: 70,787,908 L279P probably damaging Het
Mfsd4b3 T C 10: 39,947,347 T306A probably benign Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mknk1 T A 4: 115,864,561 F101I probably damaging Het
Mlc1 T C 15: 88,966,494 I154V probably benign Het
Myo5b T C 18: 74,759,240 I1685T possibly damaging Het
Nacc2 T A 2: 26,060,336 M463L probably benign Het
Nek11 A C 9: 105,244,390 Y443* probably null Het
Nme4 T C 17: 26,094,222 probably null Het
Nova1 A G 12: 46,817,018 probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Parp10 A G 15: 76,241,154 probably null Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Plce1 T C 19: 38,524,265 S3P probably damaging Het
Pnldc1 T C 17: 12,890,779 D400G probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Prmt6 A G 3: 110,249,941 I344T probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Ranbp17 C T 11: 33,500,718 R73Q possibly damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Tecpr1 C A 5: 144,206,259 A735S probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Vldlr A G 19: 27,238,313 T237A probably benign Het
Vmn1r74 C A 7: 11,846,971 T66K probably damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zmym1 C T 4: 127,049,879 V239I probably benign Het
Zmym5 T A 14: 56,797,811 T267S probably benign Het
Other mutations in Ccl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Ccl2 APN 11 82035732 missense possibly damaging 0.83
IGL01807:Ccl2 APN 11 82035687 missense possibly damaging 0.88
R2227:Ccl2 UTSW 11 82036601 critical splice donor site probably null
R3772:Ccl2 UTSW 11 82036958 missense probably damaging 1.00
R5049:Ccl2 UTSW 11 82036507 missense probably damaging 0.99
R5073:Ccl2 UTSW 11 82037158 intron probably benign
R6289:Ccl2 UTSW 11 82036969 missense probably benign 0.03
R7041:Ccl2 UTSW 11 82035663 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCTCCATGTATACCAG -3'
(R):5'- GGATCCACACCTTGCATTTAAG -3'

Sequencing Primer
(F):5'- CAGACTGAACTTCATCTAACAGTGTC -3'
(R):5'- TTCATGAAAGGGAATACCATAACATC -3'
Posted On2015-04-30