Incidental Mutation 'R0386:Ralgapa1'
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R0386 (G1)
Quality Score225
Status Validated
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55708067 bp
Amino Acid Change Histidine to Glutamine at position 1193 (H1193Q)
Ref Sequence ENSEMBL: ENSMUSP00000151857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably benign
Transcript: ENSMUST00000085385
AA Change: H1146Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: H1146Q

low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
AA Change: H1146Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: H1146Q

low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
AA Change: H1193Q

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219529
Predicted Effect probably benign
Transcript: ENSMUST00000220367
AA Change: H1146Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect unknown
Transcript: ENSMUST00000226244
AA Change: H1602Q
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
wickedwarlock UTSW 12 55777292 missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 splice site probably null
R2203:Ralgapa1 UTSW 12 55612800 splice site probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55782846 missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55722914 missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55741523 missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55659062 missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55676518 missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55739413 missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55738217 missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55738316 missense not run
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tttccccctattaaggagctaac -3'
Posted On2013-04-24