Mutagenetix > Incidental Mutations

Incidental Mutation 'R4027:Carmil1'

313055

Institutional Source

Beutler Lab

Gene Symbol

Carmil1

Ensembl Gene

ENSMUSG00000021338

Gene Name

capping protein regulator and myosin 1 linker 1

Synonyms

1110037D04Rik, Lrrc16, Lrrc16a, Carmil

MMRRC Submission

040850-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24012344-24280795 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 24067223 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000125901]

Predicted Effect

probably benign
Transcript: ENSMUST00000072889

SMART Domains

Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
LRR	245	272	2.42e1	SMART
LRR	275	302	1.04e1	SMART
LRR	304	331	3.1e0	SMART
LRR	336	363	5.66e1	SMART
Blast:LRR	423	450	9e-8	BLAST
Blast:LRR	451	484	7e-9	BLAST
LRR	574	601	8.81e-2	SMART
Blast:LRR	602	629	6e-10	BLAST
low complexity region	745	758	N/A	INTRINSIC
Pfam:CARMIL_C	790	1083	1.1e-101	PFAM
low complexity region	1131	1147	N/A	INTRINSIC
low complexity region	1245	1251	N/A	INTRINSIC
low complexity region	1253	1268	N/A	INTRINSIC
low complexity region	1287	1296	N/A	INTRINSIC
low complexity region	1317	1332	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110398

SMART Domains

Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
LRR	245	272	2.42e1	SMART
LRR	275	302	1.04e1	SMART
LRR	304	331	3.1e0	SMART
LRR	336	363	5.66e1	SMART
Blast:LRR	423	450	9e-8	BLAST
LRR	451	480	3.15e1	SMART
Pfam:LRR_6	481	507	1.9e-2	PFAM
LRR	570	597	8.81e-2	SMART
Blast:LRR	598	625	6e-10	BLAST
low complexity region	741	754	N/A	INTRINSIC
low complexity region	879	888	N/A	INTRINSIC
PDB:3LK3\|T	964	1076	1e-56	PDB
low complexity region	1127	1143	N/A	INTRINSIC
low complexity region	1241	1247	N/A	INTRINSIC
low complexity region	1249	1264	N/A	INTRINSIC
low complexity region	1283	1292	N/A	INTRINSIC
low complexity region	1313	1325	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125901

SMART Domains

Protein: ENSMUSP00000126522
Gene: ENSMUSG00000021338

Domain	Start	End	E-Value	Type
Blast:LRR	13	40	5e-8	BLAST
Blast:LRR	41	74	4e-9	BLAST
Pfam:LRR_6	75	101	4.4e-2	PFAM
Pfam:LRR_6	164	187	1.6e-3	PFAM
Blast:LRR	192	219	7e-10	BLAST
low complexity region	335	348	N/A	INTRINSIC
low complexity region	473	482	N/A	INTRINSIC
PDB:3LK3\|T	564	676	4e-57	PDB
low complexity region	727	743	N/A	INTRINSIC
low complexity region	841	847	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC
low complexity region	883	892	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142171

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

97% (60/62)

MGI Phenotype

PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	A	G	2: 35,380,396	F98L	probably damaging	Het
Adam26b	T	C	8: 43,520,372	N531S	probably benign	Het
Ahdc1	T	C	4: 133,064,165	S906P	possibly damaging	Het
Ank	A	G	15: 27,544,257	N35D	probably damaging	Het
Ano10	A	G	9: 122,252,928		probably benign	Het
Atp4a	T	C	7: 30,724,952		probably null	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Ccl2	A	G	11: 82,037,059	R110G	probably benign	Het
Cntnap2	C	A	6: 46,856,128	F758L	probably benign	Het
Cog6	A	C	3: 53,002,529	D267E	possibly damaging	Het
Cyp4f37	G	T	17: 32,631,672	E366D	probably benign	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Dpep1	T	C	8: 123,194,153	V24A	probably benign	Het
Eefsec	T	C	6: 88,376,250	I48V	probably benign	Het
Elmo2	G	A	2: 165,294,249	Q195*	probably null	Het
Ephb3	A	G	16: 21,221,697	D561G	probably damaging	Het
Erich2	C	A	2: 70,512,790		probably benign	Het
Gatm	A	G	2: 122,597,446	V362A	probably damaging	Het
Gdf10	A	G	14: 33,932,615	M360V	probably damaging	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Hectd1	T	A	12: 51,802,436		probably null	Het
Insrr	A	G	3: 87,809,599	E682G	probably benign	Het
Itgax	A	G	7: 128,141,266	I742V	possibly damaging	Het
Kcnh1	T	C	1: 192,276,699	V187A	probably benign	Het
Kdm6b	G	T	11: 69,406,268	S419R	possibly damaging	Het
Kmt2a	A	T	9: 44,836,693		probably benign	Het
Krt10	A	G	11: 99,386,193		probably benign	Het
Lct	G	A	1: 128,285,181	R1912C	probably benign	Het
Lefty1	T	C	1: 180,937,781	S305P	probably benign	Het
Mast3	A	G	8: 70,787,908	L279P	probably damaging	Het
Mfsd4b3	T	C	10: 39,947,347	T306A	probably benign	Het
Mgam	G	A	6: 40,754,902	R1351Q	probably damaging	Het
Mknk1	T	A	4: 115,864,561	F101I	probably damaging	Het
Mlc1	T	C	15: 88,966,494	I154V	probably benign	Het
Myo5b	T	C	18: 74,759,240	I1685T	possibly damaging	Het
Nacc2	T	A	2: 26,060,336	M463L	probably benign	Het
Nek11	A	C	9: 105,244,390	Y443*	probably null	Het
Nme4	T	C	17: 26,094,222		probably null	Het
Nova1	A	G	12: 46,817,018		probably benign	Het
Olfr651	A	T	7: 104,553,323	I135F	possibly damaging	Het
Parp10	A	G	15: 76,241,154		probably null	Het
Pkd1l3	T	A	8: 109,623,971	S483T	possibly damaging	Het
Plce1	T	C	19: 38,524,265	S3P	probably damaging	Het
Pnldc1	T	C	17: 12,890,779	D400G	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Prmt6	A	G	3: 110,249,941	I344T	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Ranbp17	C	T	11: 33,500,718	R73Q	possibly damaging	Het
Rcn1	G	T	2: 105,399,050	Y52*	probably null	Het
Reck	T	C	4: 43,922,931	I402T	probably damaging	Het
Tecpr1	C	A	5: 144,206,259	A735S	probably benign	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ube4a	G	A	9: 44,949,900		probably benign	Het
Vldlr	A	G	19: 27,238,313	T237A	probably benign	Het
Vmn1r74	C	A	7: 11,846,971	T66K	probably damaging	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Zmym1	C	T	4: 127,049,879	V239I	probably benign	Het
Zmym5	T	A	14: 56,797,811	T267S	probably benign	Het

Other mutations in Carmil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Carmil1	APN	13	24111838	missense	possibly damaging	0.68
IGL00392:Carmil1	APN	13	24094491	missense	probably damaging	1.00
IGL00943:Carmil1	APN	13	24111886	missense	possibly damaging	0.48
IGL01375:Carmil1	APN	13	24094471	missense	possibly damaging	0.88
IGL02043:Carmil1	APN	13	24024316	unclassified	probably benign
IGL02122:Carmil1	APN	13	24036558	missense	possibly damaging	0.95
IGL02178:Carmil1	APN	13	24094403	missense	probably damaging	1.00
IGL02264:Carmil1	APN	13	24075716	missense	possibly damaging	0.95
IGL02269:Carmil1	APN	13	24155410	nonsense	probably null
IGL02546:Carmil1	APN	13	24115499	missense	probably damaging	0.98
IGL02740:Carmil1	APN	13	24094518	missense	probably damaging	0.98
IGL02876:Carmil1	APN	13	24154668	unclassified	probably benign
IGL02976:Carmil1	APN	13	24092551	missense	possibly damaging	0.96
IGL03012:Carmil1	APN	13	24036372	missense	probably benign	0.19
IGL03107:Carmil1	APN	13	24094455	missense	probably damaging	0.99
H8562:Carmil1	UTSW	13	24064647	missense	probably benign	0.00
R0085:Carmil1	UTSW	13	24025867	missense	probably benign
R0119:Carmil1	UTSW	13	24082020	missense	probably damaging	0.98
R0166:Carmil1	UTSW	13	24099049	missense	probably damaging	1.00
R0299:Carmil1	UTSW	13	24082020	missense	probably damaging	0.98
R0304:Carmil1	UTSW	13	24139341	missense	probably damaging	0.99
R0335:Carmil1	UTSW	13	24073983	missense	probably damaging	1.00
R0369:Carmil1	UTSW	13	24082020	missense	probably damaging	0.98
R0462:Carmil1	UTSW	13	24022511	missense	probably benign	0.01
R1203:Carmil1	UTSW	13	24099006	missense	probably damaging	1.00
R1540:Carmil1	UTSW	13	24099054	missense	possibly damaging	0.92
R1730:Carmil1	UTSW	13	24041689	missense	probably damaging	1.00
R1770:Carmil1	UTSW	13	24173674	missense	probably damaging	1.00
R1831:Carmil1	UTSW	13	24164879	missense	probably benign	0.00
R1893:Carmil1	UTSW	13	24024463	missense	possibly damaging	0.72
R2099:Carmil1	UTSW	13	24173667	missense	probably benign	0.00
R2153:Carmil1	UTSW	13	24141673	missense	probably damaging	0.97
R2296:Carmil1	UTSW	13	24115509	missense	probably damaging	1.00
R2869:Carmil1	UTSW	13	24045068	synonymous	silent
R2872:Carmil1	UTSW	13	24045068	synonymous	silent
R3113:Carmil1	UTSW	13	24069757	missense	probably benign	0.22
R3508:Carmil1	UTSW	13	24019676	utr 3 prime	probably benign
R3780:Carmil1	UTSW	13	24137169	missense	probably damaging	0.99
R3954:Carmil1	UTSW	13	24013407	missense	probably benign	0.00
R4086:Carmil1	UTSW	13	24024461	missense	possibly damaging	0.56
R4647:Carmil1	UTSW	13	24137179	missense	probably damaging	1.00
R4792:Carmil1	UTSW	13	24067190	missense	probably damaging	1.00
R4792:Carmil1	UTSW	13	24141676	missense	possibly damaging	0.96
R5012:Carmil1	UTSW	13	24024420	missense	possibly damaging	0.81
R5166:Carmil1	UTSW	13	24154983	critical splice donor site	probably null
R5199:Carmil1	UTSW	13	24111870	missense	probably damaging	1.00
R5330:Carmil1	UTSW	13	24025946	splice site	probably null
R5472:Carmil1	UTSW	13	24155471	missense	probably damaging	0.97
R5478:Carmil1	UTSW	13	24112045	missense	probably damaging	1.00
R5496:Carmil1	UTSW	13	24155450	missense	probably damaging	1.00
R5775:Carmil1	UTSW	13	24276537	missense	probably benign
R5789:Carmil1	UTSW	13	24121848	missense	probably damaging	1.00
R5794:Carmil1	UTSW	13	24092550	missense	probably damaging	1.00
R5977:Carmil1	UTSW	13	24069736	missense	probably damaging	1.00
R6127:Carmil1	UTSW	13	24036352	missense	probably benign	0.03
R6128:Carmil1	UTSW	13	24013194	nonsense	probably null
R6403:Carmil1	UTSW	13	24081967	missense	probably damaging	1.00
R6450:Carmil1	UTSW	13	24036564	missense	probably damaging	0.98
R6451:Carmil1	UTSW	13	24092558	nonsense	probably null
R6684:Carmil1	UTSW	13	24022542	missense	unknown
R6891:Carmil1	UTSW	13	24141723	missense	probably benign	0.13
R6902:Carmil1	UTSW	13	24115545	missense	possibly damaging	0.79
R6924:Carmil1	UTSW	13	24075684	nonsense	probably null
R6946:Carmil1	UTSW	13	24115545	missense	possibly damaging	0.79
R7038:Carmil1	UTSW	13	24139335	missense	probably damaging	1.00
R7179:Carmil1	UTSW	13	24020069	missense	probably benign	0.00
R7282:Carmil1	UTSW	13	24013404	missense	probably benign
R7286:Carmil1	UTSW	13	24013394	missense	probably damaging	0.96
R7397:Carmil1	UTSW	13	24044311	missense	probably damaging	0.99
R7412:Carmil1	UTSW	13	24098810	missense	possibly damaging	0.50
R7611:Carmil1	UTSW	13	24013332	missense	probably benign	0.30
R7642:Carmil1	UTSW	13	24067206	missense	probably benign	0.12
R7827:Carmil1	UTSW	13	24036438	missense	probably benign	0.00
X0025:Carmil1	UTSW	13	24099043	missense	possibly damaging	0.47
Z1088:Carmil1	UTSW	13	24044182	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTATCAATCATGCTGAGAGAAGAC -3'
(R):5'- TTGACAATGGGCGCCTGATC -3'

Sequencing Primer
(F):5'- TCATGCTGAGAGAAGACAGAAAAG -3'
(R):5'- AGTTACTTTGGAGGAATCCTTAGTCC -3'

Posted On

2015-04-30