Incidental Mutation 'R0386:Dnah5'
ID 31308
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 038592-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Essential gene? Probably essential (E-score: 0.776) question?
Stock # R0386 (G1)
Quality Score 187
Status Validated
Chromosome 15
Chromosomal Location 28203752-28472052 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28383581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 2983 (Y2983F)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067048
AA Change: Y2983F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: Y2983F

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Meta Mutation Damage Score 0.6196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 (GRCm38) V194A probably damaging Het
Adamts13 G A 2: 26,986,679 (GRCm38) probably null Het
Ahnak T C 19: 9,011,144 (GRCm38) M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 (GRCm38) C1409S probably damaging Het
Camta1 C A 4: 151,075,140 (GRCm38) R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 (GRCm38) V3161A probably damaging Het
Dnah6 G A 6: 73,083,124 (GRCm38) L2774F probably damaging Het
Dst A T 1: 34,217,836 (GRCm38) T4398S probably damaging Het
Efcab5 A T 11: 77,172,378 (GRCm38) M96K probably benign Het
Efcab5 G A 11: 77,140,923 (GRCm38) R42W probably damaging Het
Elavl4 A G 4: 110,206,705 (GRCm38) probably benign Het
Flt4 G A 11: 49,644,386 (GRCm38) A1214T probably benign Het
Fn1 G T 1: 71,595,786 (GRCm38) T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 (GRCm38) S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 (GRCm38) Y269F probably damaging Het
Ghitm A G 14: 37,125,911 (GRCm38) S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 (GRCm38) noncoding transcript Het
Gm16380 T A 9: 53,884,443 (GRCm38) noncoding transcript Het
Gm9869 A T 9: 60,838,062 (GRCm38) probably benign Het
Gm9936 G A 5: 114,857,131 (GRCm38) Q142* probably null Het
Hmbs T C 9: 44,337,008 (GRCm38) Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 (GRCm38) C193* probably null Het
Idh2 C T 7: 80,098,257 (GRCm38) A232T probably damaging Het
Lce1j T C 3: 92,789,388 (GRCm38) K28E unknown Het
Lpgat1 C T 1: 191,719,348 (GRCm38) probably benign Het
Lyst T C 13: 13,708,214 (GRCm38) probably benign Het
Megf11 A G 9: 64,640,078 (GRCm38) N235D probably damaging Het
Mst1r T A 9: 107,916,804 (GRCm38) probably null Het
Nr2c2ap A G 8: 70,131,587 (GRCm38) D9G probably benign Het
Obscn T C 11: 59,136,339 (GRCm38) T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 (GRCm38) L188* probably null Het
Olfr1028 A G 2: 85,951,873 (GRCm38) E270G probably damaging Het
Olfr432 A T 1: 174,050,399 (GRCm38) T9S probably benign Het
Oma1 A T 4: 103,325,201 (GRCm38) probably benign Het
Pcm1 T C 8: 41,316,023 (GRCm38) F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 (GRCm38) M1T probably null Het
Pnpla5 G T 15: 84,120,719 (GRCm38) L144M probably damaging Het
Prdm10 C A 9: 31,316,300 (GRCm38) T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 (GRCm38) H1193Q probably benign Het
Sall1 A G 8: 89,032,604 (GRCm38) S291P probably damaging Het
Sdk2 T C 11: 113,893,464 (GRCm38) T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 (GRCm38) Y170F probably benign Het
Sema4a C T 3: 88,436,800 (GRCm38) V715I possibly damaging Het
Smgc G A 15: 91,854,638 (GRCm38) A500T probably benign Het
Spef2 A G 15: 9,584,062 (GRCm38) V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 (GRCm38) probably benign Het
Tbc1d23 G A 16: 57,189,273 (GRCm38) H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 (GRCm38) L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 (GRCm38) probably null Het
Trp53bp1 G T 2: 121,204,943 (GRCm38) T1609K probably damaging Het
Tut1 A G 19: 8,955,555 (GRCm38) N84S probably benign Het
Urb1 C T 16: 90,796,399 (GRCm38) G282R probably damaging Het
Usp19 A T 9: 108,499,711 (GRCm38) D1160V probably damaging Het
Usp9y A G Y: 1,316,933 (GRCm38) V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 (GRCm38) Y386* probably null Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,342 (GRCm38) missense probably benign
IGL00331:Dnah5 APN 15 28,421,620 (GRCm38) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,218 (GRCm38) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,702 (GRCm38) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,003 (GRCm38) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,399 (GRCm38) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,656 (GRCm38) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,294,913 (GRCm38) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,272 (GRCm38) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,490 (GRCm38) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,540 (GRCm38) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,669 (GRCm38) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,726 (GRCm38) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,726 (GRCm38) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,652 (GRCm38) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,637 (GRCm38) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,334 (GRCm38) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,782 (GRCm38) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,169 (GRCm38) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,364 (GRCm38) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,753 (GRCm38) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,289 (GRCm38) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,536 (GRCm38) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,552 (GRCm38) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,118 (GRCm38) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,041 (GRCm38) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,124 (GRCm38) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,247,885 (GRCm38) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,240 (GRCm38) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,381 (GRCm38) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,150 (GRCm38) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,276 (GRCm38) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,047 (GRCm38) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,622 (GRCm38) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,187 (GRCm38) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,296 (GRCm38) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,143 (GRCm38) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,243 (GRCm38) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,212 (GRCm38) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,625 (GRCm38) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,426 (GRCm38) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,185 (GRCm38) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,461 (GRCm38) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,325 (GRCm38) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,399 (GRCm38) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,163 (GRCm38) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,154 (GRCm38) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,148 (GRCm38) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,649 (GRCm38) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,295 (GRCm38) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,419,940 (GRCm38) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,141 (GRCm38) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,327 (GRCm38) missense possibly damaging 0.95
Firtel UTSW 15 28,448,367 (GRCm38) missense possibly damaging 0.95
lowbar UTSW 15 28,311,133 (GRCm38) splice site probably null
notherone UTSW 15 28,340,406 (GRCm38) missense probably benign 0.13
scheffler UTSW 15 28,438,091 (GRCm38) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,400 (GRCm38) missense probably benign
P0008:Dnah5 UTSW 15 28,302,387 (GRCm38) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,473 (GRCm38) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,577 (GRCm38) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,517 (GRCm38) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,613 (GRCm38) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,239,934 (GRCm38) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,751 (GRCm38) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,751 (GRCm38) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,353 (GRCm38) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,679 (GRCm38) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,363 (GRCm38) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,319 (GRCm38) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,294,925 (GRCm38) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,070 (GRCm38) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,110 (GRCm38) missense probably benign 0.19
R0421:Dnah5 UTSW 15 28,229,541 (GRCm38) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,599 (GRCm38) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,321 (GRCm38) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,779 (GRCm38) missense probably benign
R0720:Dnah5 UTSW 15 28,313,861 (GRCm38) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,143 (GRCm38) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,187 (GRCm38) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,186 (GRCm38) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,487 (GRCm38) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,599 (GRCm38) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,471 (GRCm38) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,452 (GRCm38) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,690 (GRCm38) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,690 (GRCm38) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,257 (GRCm38) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,731 (GRCm38) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,731 (GRCm38) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,511 (GRCm38) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,313,918 (GRCm38) splice site probably benign
R1401:Dnah5 UTSW 15 28,401,913 (GRCm38) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,409 (GRCm38) missense probably benign
R1430:Dnah5 UTSW 15 28,345,857 (GRCm38) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,542 (GRCm38) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,463 (GRCm38) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,463 (GRCm38) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,003 (GRCm38) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,177 (GRCm38) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,423 (GRCm38) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,423 (GRCm38) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,180 (GRCm38) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,294,985 (GRCm38) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,148 (GRCm38) missense probably benign
R1755:Dnah5 UTSW 15 28,326,636 (GRCm38) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,786 (GRCm38) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,786 (GRCm38) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,426 (GRCm38) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,400 (GRCm38) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,400 (GRCm38) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,124 (GRCm38) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,669 (GRCm38) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,713 (GRCm38) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,713 (GRCm38) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,270 (GRCm38) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,388 (GRCm38) splice site probably null
R2121:Dnah5 UTSW 15 28,297,005 (GRCm38) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,321 (GRCm38) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,321 (GRCm38) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,091 (GRCm38) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,545 (GRCm38) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,671 (GRCm38) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,417 (GRCm38) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,417 (GRCm38) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,302 (GRCm38) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,767 (GRCm38) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,313,882 (GRCm38) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,391 (GRCm38) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,576 (GRCm38) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,091 (GRCm38) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,267 (GRCm38) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,791 (GRCm38) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,420 (GRCm38) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,122 (GRCm38) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,510 (GRCm38) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,420,998 (GRCm38) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,298 (GRCm38) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,791 (GRCm38) missense probably benign
R4245:Dnah5 UTSW 15 28,219,189 (GRCm38) missense probably benign
R4254:Dnah5 UTSW 15 28,438,102 (GRCm38) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,102 (GRCm38) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,229 (GRCm38) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,154 (GRCm38) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,763 (GRCm38) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,250 (GRCm38) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,599 (GRCm38) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,419,994 (GRCm38) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,401,953 (GRCm38) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,260 (GRCm38) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,375 (GRCm38) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,420,955 (GRCm38) splice site probably null
R4767:Dnah5 UTSW 15 28,270,474 (GRCm38) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,807 (GRCm38) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,638 (GRCm38) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,792 (GRCm38) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,387,904 (GRCm38) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,557 (GRCm38) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,372 (GRCm38) missense probably benign
R5033:Dnah5 UTSW 15 28,421,678 (GRCm38) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,292 (GRCm38) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,404 (GRCm38) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,278 (GRCm38) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,172 (GRCm38) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,665 (GRCm38) missense probably benign
R5308:Dnah5 UTSW 15 28,229,651 (GRCm38) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,328 (GRCm38) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,244 (GRCm38) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,726 (GRCm38) missense probably benign
R5596:Dnah5 UTSW 15 28,343,608 (GRCm38) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,419,932 (GRCm38) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,435 (GRCm38) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,064 (GRCm38) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,367 (GRCm38) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,401,868 (GRCm38) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,152 (GRCm38) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,821 (GRCm38) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,592 (GRCm38) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,195 (GRCm38) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,013 (GRCm38) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,453 (GRCm38) splice site probably null
R5896:Dnah5 UTSW 15 28,272,060 (GRCm38) missense probably benign
R5899:Dnah5 UTSW 15 28,448,367 (GRCm38) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,833 (GRCm38) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,327 (GRCm38) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,718 (GRCm38) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,208 (GRCm38) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,207 (GRCm38) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,279 (GRCm38) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,584 (GRCm38) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,282 (GRCm38) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,226 (GRCm38) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,327,884 (GRCm38) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,833 (GRCm38) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,468 (GRCm38) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,420 (GRCm38) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,231 (GRCm38) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,185 (GRCm38) missense probably benign
R6154:Dnah5 UTSW 15 28,204,031 (GRCm38) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,343 (GRCm38) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,627 (GRCm38) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,411 (GRCm38) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,511 (GRCm38) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,824 (GRCm38) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,183 (GRCm38) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,745 (GRCm38) missense probably benign
R6607:Dnah5 UTSW 15 28,445,200 (GRCm38) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,120 (GRCm38) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,787 (GRCm38) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,487 (GRCm38) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,156 (GRCm38) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,238 (GRCm38) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,463 (GRCm38) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,515 (GRCm38) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,624 (GRCm38) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,640 (GRCm38) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,268 (GRCm38) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,720 (GRCm38) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,062 (GRCm38) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,592 (GRCm38) missense probably benign
R7032:Dnah5 UTSW 15 28,326,650 (GRCm38) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,248 (GRCm38) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,336 (GRCm38) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,264 (GRCm38) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,837 (GRCm38) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,522 (GRCm38) splice site probably null
R7209:Dnah5 UTSW 15 28,459,225 (GRCm38) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,838 (GRCm38) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,470 (GRCm38) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,819 (GRCm38) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,378 (GRCm38) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,346,952 (GRCm38) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,450 (GRCm38) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,415 (GRCm38) missense probably benign
R7519:Dnah5 UTSW 15 28,390,483 (GRCm38) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,066 (GRCm38) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,243 (GRCm38) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,346,952 (GRCm38) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,401,868 (GRCm38) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,247,979 (GRCm38) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,232 (GRCm38) splice site probably null
R7763:Dnah5 UTSW 15 28,313,855 (GRCm38) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,532 (GRCm38) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,812 (GRCm38) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,684 (GRCm38) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,414 (GRCm38) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,596 (GRCm38) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,222 (GRCm38) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,837 (GRCm38) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,177 (GRCm38) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,583 (GRCm38) missense probably benign
R8084:Dnah5 UTSW 15 28,387,953 (GRCm38) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,402 (GRCm38) missense probably benign
R8114:Dnah5 UTSW 15 28,239,976 (GRCm38) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,373 (GRCm38) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,430 (GRCm38) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,704 (GRCm38) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,133 (GRCm38) splice site probably null
R8187:Dnah5 UTSW 15 28,384,209 (GRCm38) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,268 (GRCm38) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,392 (GRCm38) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,597 (GRCm38) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,346,865 (GRCm38) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,666 (GRCm38) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,167 (GRCm38) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,323 (GRCm38) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,810 (GRCm38) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,343 (GRCm38) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,832 (GRCm38) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,795 (GRCm38) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,831 (GRCm38) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,268 (GRCm38) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,099 (GRCm38) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,221 (GRCm38) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,345,860 (GRCm38) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,219 (GRCm38) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,387,951 (GRCm38) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,573 (GRCm38) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,356 (GRCm38) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,188 (GRCm38) missense probably benign
R8885:Dnah5 UTSW 15 28,327,740 (GRCm38) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,569 (GRCm38) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,266 (GRCm38) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,247,958 (GRCm38) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,390,868 (GRCm38) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,666 (GRCm38) missense probably benign
R9065:Dnah5 UTSW 15 28,293,790 (GRCm38) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,419,961 (GRCm38) missense
R9118:Dnah5 UTSW 15 28,401,848 (GRCm38) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,768 (GRCm38) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,406 (GRCm38) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,334 (GRCm38) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,203,908 (GRCm38) start gained probably benign
R9302:Dnah5 UTSW 15 28,239,886 (GRCm38) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,433 (GRCm38) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,203,908 (GRCm38) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,160 (GRCm38) missense probably benign
R9424:Dnah5 UTSW 15 28,272,140 (GRCm38) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,147 (GRCm38) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,000 (GRCm38) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,327,879 (GRCm38) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,276 (GRCm38) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,140 (GRCm38) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,628 (GRCm38) missense probably benign
R9644:Dnah5 UTSW 15 28,230,504 (GRCm38) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,754 (GRCm38) missense probably benign
R9657:Dnah5 UTSW 15 28,409,943 (GRCm38) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,819 (GRCm38) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,170 (GRCm38) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,019 (GRCm38) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,381 (GRCm38) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,354 (GRCm38) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,411 (GRCm38) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,308 (GRCm38) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,477 (GRCm38) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,357 (GRCm38) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,230 (GRCm38) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,311 (GRCm38) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,403 (GRCm38) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,354 (GRCm38) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,763 (GRCm38) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCATTTTCAAAATGGCACCTGCAC -3'
(R):5'- TGCAAAGCCACAGCCCTCTGTTAG -3'

Sequencing Primer
(F):5'- CTGCACAGTCACATGACATATGAATG -3'
(R):5'- CTCTGTTAGAGGGTAACTGGACAC -3'
Posted On 2013-04-24