Incidental Mutation 'R0386:Hoxc5'
ID31310
Institutional Source Beutler Lab
Gene Symbol Hoxc5
Ensembl Gene ENSMUSG00000022485
Gene Namehomeobox C5
SynonymsHox-3.4, Hox-6.2
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R0386 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102967443-103017429 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103015352 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 193 (C193*)
Ref Sequence ENSEMBL: ENSMUSP00000001709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001709] [ENSMUST00000001711] [ENSMUST00000165375]
Predicted Effect probably null
Transcript: ENSMUST00000001709
AA Change: C193*
SMART Domains Protein: ENSMUSP00000001709
Gene: ENSMUSG00000022485
AA Change: C193*

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
HOX 155 217 3.03e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000001711
SMART Domains Protein: ENSMUSP00000001711
Gene: ENSMUSG00000001661

DomainStartEndE-ValueType
HOX 141 203 2.39e-24 SMART
low complexity region 221 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102056
Predicted Effect probably benign
Transcript: ENSMUST00000165375
SMART Domains Protein: ENSMUSP00000133561
Gene: ENSMUSG00000075394

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Hoxc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Hoxc5 APN 15 103014136 missense probably damaging 0.98
R1797:Hoxc5 UTSW 15 103014434 missense probably benign 0.00
R2021:Hoxc5 UTSW 15 103014382 splice site probably null
R4851:Hoxc5 UTSW 15 103015369 missense probably damaging 1.00
R4967:Hoxc5 UTSW 15 103015354 missense probably damaging 1.00
R5089:Hoxc5 UTSW 15 103014055 unclassified probably benign
R6718:Hoxc5 UTSW 15 103014266 splice site probably null
R6784:Hoxc5 UTSW 15 103013890 unclassified probably benign
R6927:Hoxc5 UTSW 15 103015375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGCACGCTATTCATCCC -3'
(R):5'- TGCCAAAGAAATGCGCTTTTGTCTG -3'

Sequencing Primer
(F):5'- ATTCATCCCTCCCTGGTTTGG -3'
(R):5'- TCCGCCTCAAAATCTAGAAGGAG -3'
Posted On2013-04-24