Mutagenetix > Incidental Mutations

Incidental Mutation 'R4028:Ltbp3'

313113

Institutional Source

Beutler Lab

Gene Symbol

Ltbp3

Ensembl Gene

ENSMUSG00000024940

Gene Name

latent transforming growth factor beta binding protein 3

Synonyms

Ltbp2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R4028 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5740904-5758532 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 5754022 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 854 (R854Q)

Ref Sequence

ENSEMBL: ENSMUSP00000080214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]

Predicted Effect

probably benign
Transcript: ENSMUST00000025890

SMART Domains

Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:Pkinase_Tyr	30	254	3.3e-11	PFAM
Pfam:Pkinase	31	252	2e-14	PFAM
SCOP:d1gw5a_	350	536	1e-18	SMART
low complexity region	556	577	N/A	INTRINSIC
low complexity region	608	620	N/A	INTRINSIC
coiled coil region	759	795	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081496
AA Change: R854Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: R854Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
EGF	109	138	6.76e-3	SMART
low complexity region	140	154	N/A	INTRINSIC
low complexity region	191	199	N/A	INTRINSIC
low complexity region	221	233	N/A	INTRINSIC
low complexity region	254	273	N/A	INTRINSIC
Pfam:TB	286	323	8e-9	PFAM
EGF_CA	352	392	2.08e-12	SMART
Pfam:TB	411	451	4.8e-18	PFAM
low complexity region	526	537	N/A	INTRINSIC
EGF_CA	571	612	8.71e-6	SMART
EGF_CA	613	656	2.8e-9	SMART
EGF_CA	657	699	2.48e-10	SMART
EGF_CA	700	740	4.96e-10	SMART
EGF_CA	741	781	1.69e-12	SMART
EGF_CA	782	822	1.94e-12	SMART
EGF_CA	823	862	3.27e-10	SMART
EGF_CA	863	905	3.32e-11	SMART
Pfam:TB	925	967	5.7e-16	PFAM
EGF_CA	990	1032	4.49e-8	SMART
EGF_CA	1033	1073	3.17e-8	SMART
Pfam:TB	1097	1134	1.2e-11	PFAM
EGF	1170	1203	1.53e1	SMART
EGF_CA	1204	1248	1.53e-10	SMART

Meta Mutation Damage Score

0.0730

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam12	A	T	7: 133,929,996	N503K	probably damaging	Het
Anapc2	T	A	2: 25,277,738	I439N	probably damaging	Het
Ank	A	G	15: 27,544,257	N35D	probably damaging	Het
Birc2	T	C	9: 7,819,351	N520S	probably benign	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Chrna5	T	C	9: 54,998,086	W61R	probably damaging	Het
Clec1b	G	A	6: 129,401,811	R87H	probably benign	Het
Cox7a2l	A	G	17: 83,502,640	I123T	probably benign	Het
Cyp2j5	A	T	4: 96,641,416	Y239*	probably null	Het
Dnajc6	G	A	4: 101,616,857	C485Y	probably damaging	Het
Dync1i1	C	T	6: 5,961,842	S341F	probably damaging	Het
Fam159a	G	T	4: 108,383,215	C43*	probably null	Het
Fbln1	A	G	15: 85,227,116	N157S	probably benign	Het
Gm13101	T	A	4: 143,965,784	T216S	probably benign	Het
Gpatch2	A	G	1: 187,226,140	S231G	possibly damaging	Het
Grin2b	T	C	6: 135,736,435	D816G	probably damaging	Het
Kndc1	T	A	7: 139,930,028	F1261Y	probably damaging	Het
Lefty1	T	C	1: 180,937,781	S305P	probably benign	Het
Mrc1	T	C	2: 14,238,248	S62P	probably damaging	Het
Ntrk3	T	C	7: 78,192,710	E790G	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1264	T	C	2: 90,021,223	N281S	probably damaging	Het
Olfr552	A	T	7: 102,605,293	D313V	possibly damaging	Het
Oog4	A	T	4: 143,440,200	N11K	probably benign	Het
Pibf1	A	G	14: 99,179,341	E450G	probably damaging	Het
Pkd1l3	T	A	8: 109,623,971	S483T	possibly damaging	Het
Pkdrej	A	T	15: 85,817,492	N1414K	probably benign	Het
Pld2	A	G	11: 70,554,905	N655S	probably damaging	Het
Rcn1	G	T	2: 105,399,050	Y52*	probably null	Het
Reck	T	C	4: 43,922,931	I402T	probably damaging	Het
Slc28a3	T	C	13: 58,610,756	S18G	probably benign	Het
Slc7a1	C	A	5: 148,345,812	C75F	probably benign	Het
Snrnp200	A	G	2: 127,237,566	D1865G	probably damaging	Het
Tnrc6a	T	A	7: 123,170,121	I378N	probably damaging	Het
Trim3	A	G	7: 105,618,245	V309A	probably benign	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Wrb	T	C	16: 96,145,584		probably null	Het
Zdhhc11	T	C	13: 73,977,271	L210P	probably damaging	Het

Other mutations in Ltbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Ltbp3	APN	19	5756016	missense	probably damaging	0.99
IGL00978:Ltbp3	APN	19	5754019	missense	probably benign	0.26
IGL01517:Ltbp3	APN	19	5757732	missense	possibly damaging	0.57
IGL01529:Ltbp3	APN	19	5747839	missense	probably benign	0.06
IGL03119:Ltbp3	APN	19	5757443	missense	probably damaging	0.98
csp	UTSW	19	5747688	missense	probably damaging	1.00
lilia	UTSW	19	5747857	critical splice donor site	probably null
Rapunzel	UTSW	19	5753942	nonsense	probably null
PIT4305001:Ltbp3	UTSW	19	5752067	missense	probably damaging	0.99
PIT4453001:Ltbp3	UTSW	19	5757794	missense	probably damaging	0.97
PIT4480001:Ltbp3	UTSW	19	5751226	missense	possibly damaging	0.73
R0211:Ltbp3	UTSW	19	5752143	critical splice donor site	probably null
R0718:Ltbp3	UTSW	19	5746748	splice site	probably benign
R1103:Ltbp3	UTSW	19	5747411	critical splice acceptor site	probably null
R1103:Ltbp3	UTSW	19	5747412	critical splice acceptor site	probably null
R1299:Ltbp3	UTSW	19	5745428	splice site	probably benign
R1510:Ltbp3	UTSW	19	5748887	missense	probably benign	0.02
R1616:Ltbp3	UTSW	19	5746967	missense	probably damaging	1.00
R1682:Ltbp3	UTSW	19	5751754	missense	probably benign	0.02
R1752:Ltbp3	UTSW	19	5745657	missense	probably benign	0.09
R1806:Ltbp3	UTSW	19	5753942	nonsense	probably null
R1866:Ltbp3	UTSW	19	5747849	missense	probably benign	0.43
R1981:Ltbp3	UTSW	19	5758079	missense	probably benign	0.15
R2211:Ltbp3	UTSW	19	5753962	missense	possibly damaging	0.79
R2239:Ltbp3	UTSW	19	5751523	nonsense	probably null
R2261:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2263:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2380:Ltbp3	UTSW	19	5751523	nonsense	probably null
R2412:Ltbp3	UTSW	19	5746645	missense	probably benign	0.08
R2446:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2449:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3056:Ltbp3	UTSW	19	5751406	missense	probably benign	0.11
R3080:Ltbp3	UTSW	19	5756888	frame shift	probably null
R3863:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3864:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3951:Ltbp3	UTSW	19	5756001	missense	probably damaging	1.00
R3961:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3962:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3963:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3972:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4031:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4041:Ltbp3	UTSW	19	5751871	missense	possibly damaging	0.95
R4060:Ltbp3	UTSW	19	5742320	missense	probably benign	0.41
R4296:Ltbp3	UTSW	19	5756582	critical splice acceptor site	probably null
R4525:Ltbp3	UTSW	19	5746359	missense	probably benign	0.09
R4660:Ltbp3	UTSW	19	5748786	intron	probably null
R4794:Ltbp3	UTSW	19	5756679	missense	probably damaging	1.00
R4980:Ltbp3	UTSW	19	5753927	critical splice acceptor site	probably null
R5071:Ltbp3	UTSW	19	5756823	missense	probably damaging	1.00
R5702:Ltbp3	UTSW	19	5747821	missense	probably benign
R5771:Ltbp3	UTSW	19	5747544	missense	probably damaging	1.00
R6021:Ltbp3	UTSW	19	5753680	missense	probably benign	0.00
R6053:Ltbp3	UTSW	19	5752094	missense	probably damaging	0.98
R6321:Ltbp3	UTSW	19	5745657	missense	probably benign	0.09
R6339:Ltbp3	UTSW	19	5747477	missense	probably damaging	1.00
R6371:Ltbp3	UTSW	19	5745772	splice site	probably null
R6709:Ltbp3	UTSW	19	5747857	critical splice donor site	probably null
R7666:Ltbp3	UTSW	19	5747006	missense	possibly damaging	0.79
X0066:Ltbp3	UTSW	19	5751277	missense	probably benign	0.01
Z1177:Ltbp3	UTSW	19	5747730	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATCCAGATCCCAGTTGTG -3'
(R):5'- GACTACAGAAAAGCTACAGTGTGTC -3'

Sequencing Primer
(F):5'- CATCCAGATCCCAGTTGTGATTTGAG -3'
(R):5'- GCTACAGTGTGTCAAATAGATAGAG -3'

Posted On

2015-04-30