Incidental Mutation 'R4029:Phlpp1'
ID313115
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4029 (G1)
Quality Score167
Status Validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106392549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1425 (S1425T)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably damaging
Transcript: ENSMUST00000061047
AA Change: S1425T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: S1425T

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7957:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCCATGACAGCATCAGTG -3'
(R):5'- TCAAGGCCGTTGTCAGAGAAC -3'

Sequencing Primer
(F):5'- CATCAGTGCTGTGGTGGTAC -3'
(R):5'- TTGTCAGAGAACGCGCTG -3'
Posted On2015-04-30