Incidental Mutation 'R4029:Lefty1'
ID313117
Institutional Source Beutler Lab
Gene Symbol Lefty1
Ensembl Gene ENSMUSG00000038793
Gene Nameleft right determination factor 1
Synonymslefty-1, Lefty, Stra3, Ebaf
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180935022-180938400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180937781 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000041427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000037361] [ENSMUST00000159436] [ENSMUST00000161847] [ENSMUST00000162283]
Predicted Effect probably benign
Transcript: ENSMUST00000027800
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037361
AA Change: S305P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041427
Gene: ENSMUSG00000038793
AA Change: S305P

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:TGFb_propeptide 19 237 1.6e-13 PFAM
TGFB 265 356 5.78e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132087
Predicted Effect probably benign
Transcript: ENSMUST00000159436
SMART Domains Protein: ENSMUSP00000125192
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 173 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161847
SMART Domains Protein: ENSMUSP00000124937
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162283
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in left-right asymmetry determination of organ systems during development. Mice lacking a functional copy of this gene exhibit embryonic lethality and defects in left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic and postnatal lethality, abnormal liver lobation, and a variety of left-right positional defects in visceral organs including left thoracic and atrial isomerism. A subset of mice homozygous for a differentnull allele show left pulmonary isomerism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Lefty1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Lefty1 APN 1 180937677 missense probably benign 0.01
IGL02974:Lefty1 APN 1 180935277 missense probably benign 0.21
R0230:Lefty1 UTSW 1 180937014 missense probably damaging 1.00
R0383:Lefty1 UTSW 1 180937634 nonsense probably null
R1976:Lefty1 UTSW 1 180937824 missense probably benign 0.01
R2351:Lefty1 UTSW 1 180937242 missense possibly damaging 0.80
R4027:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4028:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4030:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4719:Lefty1 UTSW 1 180937712 missense probably benign 0.01
R4761:Lefty1 UTSW 1 180937625 missense probably benign 0.40
R5476:Lefty1 UTSW 1 180937698 missense probably benign 0.06
R6151:Lefty1 UTSW 1 180935116 missense unknown
R6175:Lefty1 UTSW 1 180935149 missense unknown
R6362:Lefty1 UTSW 1 180937160 missense probably benign 0.39
R7153:Lefty1 UTSW 1 180937767 missense probably benign 0.01
R7678:Lefty1 UTSW 1 180936760 missense probably damaging 0.99
R7765:Lefty1 UTSW 1 180936547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAGGCAATTGTGACC -3'
(R):5'- TTTGCATGAAAGGCACATCC -3'

Sequencing Primer
(F):5'- CAAGGCAATTGTGACCCCGAG -3'
(R):5'- ACATCCTTGGGGAAGCCAC -3'
Posted On2015-04-30