Incidental Mutation 'R4029:Nup35'
ID313118
Institutional Source Beutler Lab
Gene Symbol Nup35
Ensembl Gene ENSMUSG00000026999
Gene Namenucleoporin 35
Synonyms2310006I24Rik, 5330402E05Rik
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location80617236-80658906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80652974 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 172 (D172G)
Ref Sequence ENSEMBL: ENSMUSP00000028382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028382] [ENSMUST00000124377]
PDB Structure
Crystal structure of the MPPN domain of mouse Nup35 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028382
AA Change: D172G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028382
Gene: ENSMUSG00000026999
AA Change: D172G

DomainStartEndE-ValueType
Pfam:Nup35_RRM 166 251 8.2e-30 PFAM
Pfam:Nup35_RRM_2 172 224 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124377
AA Change: D172G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122132
Gene: ENSMUSG00000026999
AA Change: D172G

DomainStartEndE-ValueType
PDB:4LIR|B 150 179 3e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135305
Meta Mutation Damage Score 0.1405 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The encoded protein contains two membrane binding regions, is localized to the nuclear rim, and is part of the nuclear pore complex. All molecules entering or leaving the nucleus either diffuse through or are actively transported by the nuclear pore complex. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 7 and 10. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout through a point mutation in a critical functional domain leads to early death as a result of megacolon caused by colon myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Nup35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Nup35 APN 2 80654832 missense probably damaging 1.00
IGL02039:Nup35 APN 2 80642775 missense probably benign 0.04
IGL02538:Nup35 APN 2 80644219 missense possibly damaging 0.83
IGL03167:Nup35 APN 2 80658316 unclassified probably benign
R0540:Nup35 UTSW 2 80642640 missense probably benign 0.11
R0607:Nup35 UTSW 2 80642640 missense probably benign 0.11
R4050:Nup35 UTSW 2 80655976 missense probably benign 0.30
R4130:Nup35 UTSW 2 80656099 unclassified probably benign
R4131:Nup35 UTSW 2 80656099 unclassified probably benign
R4477:Nup35 UTSW 2 80657143 unclassified probably benign
R6374:Nup35 UTSW 2 80658386 missense probably benign 0.00
R7191:Nup35 UTSW 2 80658379 missense probably damaging 1.00
R7723:Nup35 UTSW 2 80656031 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGCCCATGTGTTTTCATTGG -3'
(R):5'- ACAGCGTGCACAGGATGATC -3'

Sequencing Primer
(F):5'- CCCATGTGTTTTCATTGGTAACTAAC -3'
(R):5'- TGTCTGCAGCTCAGTGAAAC -3'
Posted On2015-04-30