Incidental Mutation 'R4029:Rcn1'
ID313119
Institutional Source Beutler Lab
Gene Symbol Rcn1
Ensembl Gene ENSMUSG00000005973
Gene Namereticulocalbin 1
SynonymsRcn
MMRRC Submission 040959-MU
Accession Numbers

Ncbi RefSeq: NM_009037.2; MGI:104559

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4029 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location105386291-105399319 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 105399050 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 52 (Y52*)
Ref Sequence ENSEMBL: ENSMUSP00000006128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006128]
Predicted Effect probably null
Transcript: ENSMUST00000006128
AA Change: Y52*
SMART Domains Protein: ENSMUSP00000006128
Gene: ENSMUSG00000005973
AA Change: Y52*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EFh 77 105 1.45e0 SMART
EFh 113 141 6.56e0 SMART
Blast:EFh 164 192 3e-9 BLAST
EFh 201 229 4.35e-2 SMART
Pfam:EF-hand_5 244 267 1.6e-4 PFAM
Blast:EFh 278 306 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127019
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Rcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Rcn1 APN 2 105394829 missense possibly damaging 0.83
IGL02347:Rcn1 APN 2 105399126 missense probably benign 0.17
californianus UTSW 2 105388975 critical splice donor site probably null
gymnogyps UTSW 2 105389173 missense probably benign 0.06
P0031:Rcn1 UTSW 2 105389069 nonsense probably null
R0107:Rcn1 UTSW 2 105394781 missense possibly damaging 0.79
R1510:Rcn1 UTSW 2 105389089 missense probably damaging 1.00
R1699:Rcn1 UTSW 2 105399005 missense probably damaging 1.00
R4027:Rcn1 UTSW 2 105399050 nonsense probably null
R4028:Rcn1 UTSW 2 105399050 nonsense probably null
R4923:Rcn1 UTSW 2 105389173 missense probably benign 0.06
R4956:Rcn1 UTSW 2 105394776 nonsense probably null
R5079:Rcn1 UTSW 2 105399057 missense probably damaging 0.96
R5333:Rcn1 UTSW 2 105389126 missense probably benign 0.00
R5709:Rcn1 UTSW 2 105394783 missense probably damaging 1.00
R6160:Rcn1 UTSW 2 105392017 missense probably damaging 1.00
R6525:Rcn1 UTSW 2 105388975 critical splice donor site probably null
R7111:Rcn1 UTSW 2 105389014 missense probably damaging 1.00
R7388:Rcn1 UTSW 2 105391991 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACCAACTGGCGCGATTTC -3'
(R):5'- CTTTCCGGTCTTGCAGAGAACC -3'

Sequencing Primer
(F):5'- CGATTTCGCTTTCGCTTTGC -3'
(R):5'- GTCTTGCAGAGAACCCTCCAGTC -3'
Posted On2015-04-30