Incidental Mutation 'R4029:Reck'
ID313122
Institutional Source Beutler Lab
Gene Symbol Reck
Ensembl Gene ENSMUSG00000028476
Gene Namereversion-inducing-cysteine-rich protein with kazal motifs
SynonymsSt15
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43875530-43944806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43922931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 402 (I402T)
Ref Sequence ENSEMBL: ENSMUSP00000030198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030198]
Predicted Effect probably damaging
Transcript: ENSMUST00000030198
AA Change: I402T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030198
Gene: ENSMUSG00000028476
AA Change: I402T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 632 671 1.18e-2 SMART
KAZAL 708 750 1.46e-2 SMART
KAZAL 753 787 4.26e-2 SMART
low complexity region 877 890 N/A INTRINSIC
low complexity region 927 946 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128463
Meta Mutation Damage Score 0.6322 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10.5-E11.5, defects in collagen fibrils, basal lamina and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Reck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Reck APN 4 43940662 missense probably damaging 1.00
IGL01569:Reck APN 4 43925172 missense probably benign 0.00
IGL02341:Reck APN 4 43925160 missense probably damaging 0.97
IGL02637:Reck APN 4 43898009 missense probably damaging 0.97
IGL02709:Reck APN 4 43913791 missense probably damaging 0.99
IGL02829:Reck APN 4 43891014 missense probably damaging 0.96
IGL02928:Reck APN 4 43912078 missense possibly damaging 0.47
IGL03132:Reck APN 4 43938898 nonsense probably null
PIT4453001:Reck UTSW 4 43895850 missense probably benign 0.00
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0607:Reck UTSW 4 43940719 missense probably benign 0.01
R0626:Reck UTSW 4 43930295 missense probably benign 0.00
R0894:Reck UTSW 4 43922967 missense probably damaging 1.00
R0932:Reck UTSW 4 43922838 missense possibly damaging 0.95
R1564:Reck UTSW 4 43912061 missense probably benign 0.00
R1633:Reck UTSW 4 43922964 missense possibly damaging 0.89
R1772:Reck UTSW 4 43890982 missense probably benign 0.00
R1968:Reck UTSW 4 43913771 splice site probably null
R2105:Reck UTSW 4 43943195 missense probably damaging 0.99
R2225:Reck UTSW 4 43922837 missense probably benign 0.01
R2302:Reck UTSW 4 43931015 missense probably benign 0.28
R2430:Reck UTSW 4 43930202 missense possibly damaging 0.88
R2655:Reck UTSW 4 43938966 missense probably benign 0.01
R3858:Reck UTSW 4 43930261 missense probably benign 0.13
R4027:Reck UTSW 4 43922931 missense probably damaging 1.00
R4028:Reck UTSW 4 43922931 missense probably damaging 1.00
R4080:Reck UTSW 4 43942293 missense possibly damaging 0.95
R4497:Reck UTSW 4 43891001 missense probably benign
R4583:Reck UTSW 4 43931062 critical splice donor site probably null
R4702:Reck UTSW 4 43898060 missense probably damaging 1.00
R5934:Reck UTSW 4 43930979 missense probably damaging 1.00
R6114:Reck UTSW 4 43922895 missense probably damaging 1.00
R6235:Reck UTSW 4 43937450 missense probably damaging 1.00
R7895:Reck UTSW 4 43890970 missense probably benign 0.00
R7903:Reck UTSW 4 43927166 missense possibly damaging 0.49
R7978:Reck UTSW 4 43890970 missense probably benign 0.00
R7986:Reck UTSW 4 43927166 missense possibly damaging 0.49
R8047:Reck UTSW 4 43927221 missense probably damaging 1.00
X0062:Reck UTSW 4 43922921 missense probably damaging 1.00
X0067:Reck UTSW 4 43914016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCTGAAAGCCTATGGTGG -3'
(R):5'- GTTCTAAAGAGAGGCTGGGC -3'

Sequencing Primer
(F):5'- GCGCTCTCTCTTTAAGAAAATCAG -3'
(R):5'- GCTGGGCTAGCGATGAG -3'
Posted On2015-04-30