Incidental Mutation 'R4029:Fam159a'
ID313123
Institutional Source Beutler Lab
Gene Symbol Fam159a
Ensembl Gene ENSMUSG00000059816
Gene Namefamily with sequence similarity 159, member A
SynonymsOTTMUSG00000008243
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4029 (G1)
Quality Score211
Status Validated
Chromosome4
Chromosomal Location108367777-108383349 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 108383215 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 43 (C43*)
Ref Sequence ENSEMBL: ENSMUSP00000060463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053157]
Predicted Effect probably null
Transcript: ENSMUST00000053157
AA Change: C43*
SMART Domains Protein: ENSMUSP00000060463
Gene: ENSMUSG00000059816
AA Change: C43*

DomainStartEndE-ValueType
transmembrane domain 56 90 N/A INTRINSIC
low complexity region 131 139 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Fam159a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:Fam159a APN 4 108368028 missense probably benign 0.02
IGL03247:Fam159a APN 4 108367901 missense probably benign 0.00
R4028:Fam159a UTSW 4 108383215 nonsense probably null
R4030:Fam159a UTSW 4 108383215 nonsense probably null
R4890:Fam159a UTSW 4 108367801 missense probably benign
R4911:Fam159a UTSW 4 108377461 missense probably benign 0.11
R6190:Fam159a UTSW 4 108367855 missense probably damaging 1.00
R6647:Fam159a UTSW 4 108368027 missense probably benign 0.00
R7128:Fam159a UTSW 4 108367903 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTTTGATGTGGTACAAAGC -3'
(R):5'- TTCTCAAGATCTGCGGGGTC -3'

Sequencing Primer
(F):5'- TCAGTGAGGAGTAAGGATGATTTG -3'
(R):5'- GGTCTCCGGCCGTTGTCTC -3'
Posted On2015-04-30