Incidental Mutation 'R4029:Gm13101'
ID313125
Institutional Source Beutler Lab
Gene Symbol Gm13101
Ensembl Gene ENSMUSG00000078510
Gene Namepredicted gene 13101
Synonyms
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143964518-143966950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143965784 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 216 (T216S)
Ref Sequence ENSEMBL: ENSMUSP00000101389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105763]
Predicted Effect probably benign
Transcript: ENSMUST00000105763
AA Change: T216S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: T216S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 2e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Gm13101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Gm13101 APN 4 143966614 splice site probably benign
IGL00688:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00690:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00693:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00694:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL01412:Gm13101 APN 4 143964995 missense probably damaging 1.00
IGL01781:Gm13101 APN 4 143965729 missense probably benign
IGL02426:Gm13101 APN 4 143966659 missense possibly damaging 0.75
IGL02508:Gm13101 APN 4 143965020 missense probably benign 0.13
IGL03338:Gm13101 APN 4 143965841 missense probably benign 0.01
IGL03338:Gm13101 APN 4 143966038 missense probably benign 0.03
R0201:Gm13101 UTSW 4 143964890 missense probably damaging 1.00
R0325:Gm13101 UTSW 4 143966740 missense probably damaging 1.00
R0538:Gm13101 UTSW 4 143965083 missense possibly damaging 0.76
R1471:Gm13101 UTSW 4 143964953 missense probably benign 0.25
R1544:Gm13101 UTSW 4 143966062 missense probably benign 0.00
R1891:Gm13101 UTSW 4 143966665 missense probably damaging 1.00
R2012:Gm13101 UTSW 4 143966067 missense probably benign 0.00
R2105:Gm13101 UTSW 4 143965820 missense probably benign
R2939:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R2940:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R3723:Gm13101 UTSW 4 143966681 missense probably benign
R3952:Gm13101 UTSW 4 143965786 nonsense probably null
R4028:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R4030:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R5059:Gm13101 UTSW 4 143964995 missense probably damaging 0.99
R5222:Gm13101 UTSW 4 143964792 missense possibly damaging 0.55
R5591:Gm13101 UTSW 4 143964960 missense probably damaging 1.00
R5677:Gm13101 UTSW 4 143965138 missense possibly damaging 0.59
R6021:Gm13101 UTSW 4 143965766 missense probably benign
R6042:Gm13101 UTSW 4 143966061 missense probably benign 0.04
R6155:Gm13101 UTSW 4 143965142 missense probably benign 0.00
R6604:Gm13101 UTSW 4 143965997 missense probably benign 0.02
R6807:Gm13101 UTSW 4 143965011 missense probably damaging 1.00
R7244:Gm13101 UTSW 4 143965885 missense probably benign
R7505:Gm13101 UTSW 4 143964986 missense probably benign 0.00
R7526:Gm13101 UTSW 4 143965817 missense probably benign 0.00
Z1088:Gm13101 UTSW 4 143965562 missense probably benign
Z1177:Gm13101 UTSW 4 143965591 missense probably benign 0.42
Z1177:Gm13101 UTSW 4 143965775 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAGATGCTGGAGACTGTTG -3'
(R):5'- CTAAGGAGACGTTTAAAGGTGGTC -3'

Sequencing Primer
(F):5'- AGACTGTTGAGTTTGGGGAAC -3'
(R):5'- ACGTTTAAAGGTGGTCACTGAC -3'
Posted On2015-04-30