Incidental Mutation 'R4029:Dcun1d4'
ID313127
Institutional Source Beutler Lab
Gene Symbol Dcun1d4
Ensembl Gene ENSMUSG00000051674
Gene NameDCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Synonyms
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73481000-73560794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73534637 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000119983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063882] [ENSMUST00000087181] [ENSMUST00000113558] [ENSMUST00000133137] [ENSMUST00000134092] [ENSMUST00000136268] [ENSMUST00000145645]
Predicted Effect probably benign
Transcript: ENSMUST00000063882
AA Change: D149G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067616
Gene: ENSMUSG00000051674
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 173 287 3.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087181
AA Change: D163G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084427
Gene: ENSMUSG00000051674
AA Change: D163G

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:Cullin_binding 189 300 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113558
AA Change: D149G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109187
Gene: ENSMUSG00000051674
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 203 252 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130087
SMART Domains Protein: ENSMUSP00000118392
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:3KEV|A 44 109 3e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133137
SMART Domains Protein: ENSMUSP00000120055
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134092
SMART Domains Protein: ENSMUSP00000118710
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136268
AA Change: D89G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119983
Gene: ENSMUSG00000051674
AA Change: D89G

DomainStartEndE-ValueType
PDB:4GBA|B 42 104 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000145645
AA Change: D89G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122689
Gene: ENSMUSG00000051674
AA Change: D89G

DomainStartEndE-ValueType
PDB:4GBA|B 42 101 1e-7 PDB
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Dcun1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Dcun1d4 APN 5 73481201 splice site probably benign
IGL02345:Dcun1d4 APN 5 73511152 missense probably damaging 0.99
IGL03264:Dcun1d4 APN 5 73520229 missense probably benign 0.00
PIT4402001:Dcun1d4 UTSW 5 73510933 missense probably benign 0.09
R1184:Dcun1d4 UTSW 5 73511112 splice site probably benign
R2266:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2267:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2268:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2269:Dcun1d4 UTSW 5 73481275 splice site probably benign
R4027:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4031:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4788:Dcun1d4 UTSW 5 73534628 missense probably damaging 1.00
R4961:Dcun1d4 UTSW 5 73544120 nonsense probably null
R5245:Dcun1d4 UTSW 5 73557314 missense probably benign 0.11
R5284:Dcun1d4 UTSW 5 73522682 unclassified probably null
R5457:Dcun1d4 UTSW 5 73531565 missense probably damaging 1.00
R5728:Dcun1d4 UTSW 5 73520148 missense possibly damaging 0.61
R6469:Dcun1d4 UTSW 5 73534614 missense probably damaging 0.99
R6813:Dcun1d4 UTSW 5 73520957 missense possibly damaging 0.90
R7165:Dcun1d4 UTSW 5 73491195 splice site probably null
R7439:Dcun1d4 UTSW 5 73491536 critical splice donor site probably null
X0063:Dcun1d4 UTSW 5 73555438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAAACCCAGACTCACTCAG -3'
(R):5'- AAGGGAGGCTTGCTACACTAC -3'

Sequencing Primer
(F):5'- AGACTCACTCAGTTTTGAAGCC -3'
(R):5'- ATGTCCTAAGTTCCCAGGAGC -3'
Posted On2015-04-30