Incidental Mutation 'R4029:Acsm4'
ID313128
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Nameacyl-CoA synthetase medium-chain family member 4
SynonymsOMACS, O-MACS
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119690026-119714565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119693785 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 46 (K46R)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
Predicted Effect probably benign
Transcript: ENSMUST00000047045
AA Change: K46R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: K46R

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119711419 nonsense probably null
IGL01676:Acsm4 APN 7 119708643 missense probably benign 0.00
IGL01801:Acsm4 APN 7 119707263 missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119693852 splice site probably null
IGL02220:Acsm4 APN 7 119711172 missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119710684 missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119703423 splice site probably benign
I0000:Acsm4 UTSW 7 119711192 missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119698575 missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119708710 missense probably benign 0.00
R1386:Acsm4 UTSW 7 119698578 missense probably benign
R1433:Acsm4 UTSW 7 119693819 missense probably damaging 0.99
R1961:Acsm4 UTSW 7 119708740 missense probably benign 0.04
R3957:Acsm4 UTSW 7 119703365 missense possibly damaging 0.93
R4072:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4075:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4076:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4432:Acsm4 UTSW 7 119711387 missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119698574 missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119698677 missense probably benign
R4992:Acsm4 UTSW 7 119711417 missense probably benign 0.43
R5046:Acsm4 UTSW 7 119703374 missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119712950 missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119694800 missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119693845 missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119711399 missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119693710 missense probably benign 0.01
R7892:Acsm4 UTSW 7 119694666 missense possibly damaging 0.48
Z1177:Acsm4 UTSW 7 119711371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCACTCCCAGTCTTCAG -3'
(R):5'- TGAAGCCATCCAGGTTCCTG -3'

Sequencing Primer
(F):5'- ACAGGCATTTCCCACTTGC -3'
(R):5'- AGGTTCCTGCCCTCACTGAG -3'
Posted On2015-04-30