Incidental Mutation 'R4029:Pld2'
ID313132
Institutional Source Beutler Lab
Gene Symbol Pld2
Ensembl Gene ENSMUSG00000020828
Gene Namephospholipase D2
Synonyms
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70540064-70558110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70554905 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 655 (N655S)
Ref Sequence ENSEMBL: ENSMUSP00000018429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018429] [ENSMUST00000108557]
Predicted Effect probably damaging
Transcript: ENSMUST00000018429
AA Change: N655S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018429
Gene: ENSMUSG00000020828
AA Change: N655S

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 751 778 4.12e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108557
AA Change: N655S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104197
Gene: ENSMUSG00000020828
AA Change: N655S

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 762 789 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179806
Meta Mutation Damage Score 0.8422 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene is a member of the phospholipase D (PLD) superfamily. The encoded protein catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. Phosphatidic acid is an essential intracellular lipid second messenger for many signaling pathways and has been implicated in a variety of physiological processes including cytoskeletal organization and cell proliferation. A similar gene in human may also function as a guanine nucleotide exchange factor (GEF) for the small GTPase Rac2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out fail to exhibit Abeta42 suppression of LTP and show altered brain phosphatidic acid levels. Mice homozygous for a different knock-out allele show normal platelet function, hemostasis and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Pld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Pld2 APN 11 70551180 nonsense probably null
IGL01094:Pld2 APN 11 70541306 missense probably damaging 0.99
IGL01696:Pld2 APN 11 70542780 missense probably damaging 1.00
IGL02165:Pld2 APN 11 70555677 missense probably damaging 1.00
IGL02477:Pld2 APN 11 70540925 missense possibly damaging 0.60
IGL02712:Pld2 APN 11 70557079 missense probably benign 0.44
IGL03013:Pld2 APN 11 70541177 missense probably damaging 1.00
R0117:Pld2 UTSW 11 70557388 missense probably benign 0.19
R0130:Pld2 UTSW 11 70554348 missense probably benign
R0508:Pld2 UTSW 11 70552542 missense probably damaging 0.98
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0974:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R1907:Pld2 UTSW 11 70544184 missense probably damaging 0.99
R2087:Pld2 UTSW 11 70542960 missense probably damaging 1.00
R2181:Pld2 UTSW 11 70542989 missense possibly damaging 0.70
R2379:Pld2 UTSW 11 70554314 missense probably benign 0.01
R3772:Pld2 UTSW 11 70544123 unclassified probably benign
R3949:Pld2 UTSW 11 70553354 missense probably benign
R4028:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4160:Pld2 UTSW 11 70541427 missense probably damaging 1.00
R4428:Pld2 UTSW 11 70541334 missense probably damaging 1.00
R4595:Pld2 UTSW 11 70542020 missense probably damaging 1.00
R4945:Pld2 UTSW 11 70555698 missense probably damaging 1.00
R5280:Pld2 UTSW 11 70552759 missense probably damaging 1.00
R5659:Pld2 UTSW 11 70557561 makesense probably null
R5773:Pld2 UTSW 11 70555932 missense probably damaging 1.00
R5900:Pld2 UTSW 11 70556062 critical splice donor site probably null
R6249:Pld2 UTSW 11 70555370 missense probably damaging 1.00
R6362:Pld2 UTSW 11 70554675 missense probably damaging 1.00
R6746:Pld2 UTSW 11 70541107 missense probably damaging 0.96
R6922:Pld2 UTSW 11 70553447 missense probably benign 0.02
R7213:Pld2 UTSW 11 70553372 missense probably benign 0.02
R7754:Pld2 UTSW 11 70552869 critical splice donor site probably null
R8122:Pld2 UTSW 11 70541433 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTGAGGTCTGACCGAGG -3'
(R):5'- AGTAGACTCGGAAACACTGCCC -3'

Sequencing Primer
(F):5'- TCTGACCGAGGCAATGGTG -3'
(R):5'- CTGCCCCTGTCTGAGAGAAAAATAG -3'
Posted On2015-04-30