Incidental Mutation 'R4029:Krt17'
ID313133
Institutional Source Beutler Lab
Gene Symbol Krt17
Ensembl Gene ENSMUSG00000035557
Gene Namekeratin 17
SynonymsKrt1-17, K17
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100256217-100261029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100257523 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 364 (N364I)
Ref Sequence ENSEMBL: ENSMUSP00000079699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080893]
Predicted Effect probably damaging
Transcript: ENSMUST00000080893
AA Change: N364I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079699
Gene: ENSMUSG00000035557
AA Change: N364I

DomainStartEndE-ValueType
Filament 83 394 9.36e-177 SMART
Meta Mutation Damage Score 0.3139 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the type I keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin required for the normal growth of hair follicles and may act in psoriasis as an immunopathogenic autoantigen. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display age- and strain-dependent alopecia associated with frequent absence of vibrissae, increased hair fragility, abnormal hair cycling, altered hair follicle morphology, and apoptosis in matrix cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Krt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Krt17 APN 11 100260631 missense probably damaging 1.00
IGL02291:Krt17 APN 11 100256493 missense probably benign 0.42
IGL03392:Krt17 APN 11 100259735 missense possibly damaging 0.73
R0189:Krt17 UTSW 11 100260619 missense possibly damaging 0.95
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R1448:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R1510:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R4235:Krt17 UTSW 11 100257868 missense possibly damaging 0.90
R4888:Krt17 UTSW 11 100256479 missense probably benign 0.06
R5281:Krt17 UTSW 11 100260701 nonsense probably null
R7213:Krt17 UTSW 11 100258530 missense probably benign 0.09
R7238:Krt17 UTSW 11 100257787 missense probably benign 0.19
R7304:Krt17 UTSW 11 100257337 missense probably benign
R7438:Krt17 UTSW 11 100258465 missense probably damaging 1.00
R7796:Krt17 UTSW 11 100260872 missense probably benign 0.23
Z1176:Krt17 UTSW 11 100260923 missense probably benign 0.23
Z1177:Krt17 UTSW 11 100259196 missense probably damaging 1.00
Z1177:Krt17 UTSW 11 100259711 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTTGTACTGAGTCAGGCTG -3'
(R):5'- TGTTATGCACCCAGGGATGG -3'

Sequencing Primer
(F):5'- TACTCACTGGGCATCCT -3'
(R):5'- CTAACACCTGGGAGTCAGCTTTG -3'
Posted On2015-04-30