Incidental Mutation 'R4029:Ston2'
ID313134
Institutional Source Beutler Lab
Gene Symbol Ston2
Ensembl Gene ENSMUSG00000020961
Gene Namestonin 2
Synonyms
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location91633009-91788387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91648263 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 457 (Q457R)
Ref Sequence ENSEMBL: ENSMUSP00000131098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052969] [ENSMUST00000164713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052969
AA Change: Q457R

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053908
Gene: ENSMUSG00000020961
AA Change: Q457R

DomainStartEndE-ValueType
Pfam:Stonin2_N 1 337 3e-228 PFAM
Pfam:Adap_comp_sub 554 873 7.3e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164713
AA Change: Q457R

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131098
Gene: ENSMUSG00000020961
AA Change: Q457R

DomainStartEndE-ValueType
Pfam:Stonin2_N 1 337 1.3e-181 PFAM
Pfam:Adap_comp_sub 554 872 1.9e-65 PFAM
Meta Mutation Damage Score 0.3836 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a membrane protein involved in regulating endocytotic complexes. The protein product is described as one of the clathrin-associated sorting proteins, adaptor molecules which ensure specific proteins are internalized. The encoded protein has also been shown to participate in synaptic vesicle recycling through interaction with synaptotagmin 1 required for neurotransmission. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit compromised endocytic synaptic vesicle sorting fidelity, hyperactivity and abnormal response to novel object. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Ston2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ston2 APN 12 91648748 missense possibly damaging 0.67
IGL02102:Ston2 APN 12 91639724 makesense probably null
IGL03177:Ston2 APN 12 91647657 missense probably damaging 1.00
IGL03233:Ston2 APN 12 91647853 missense probably damaging 1.00
PIT4305001:Ston2 UTSW 12 91648502 missense possibly damaging 0.90
R0158:Ston2 UTSW 12 91740602 missense probably damaging 1.00
R0365:Ston2 UTSW 12 91647860 missense probably benign 0.00
R0671:Ston2 UTSW 12 91740466 splice site probably null
R1005:Ston2 UTSW 12 91648848 missense possibly damaging 0.56
R1381:Ston2 UTSW 12 91740492 missense probably damaging 0.97
R1507:Ston2 UTSW 12 91641680 missense probably benign 0.02
R1737:Ston2 UTSW 12 91647907 missense probably damaging 1.00
R4030:Ston2 UTSW 12 91648263 missense possibly damaging 0.59
R4552:Ston2 UTSW 12 91641872 missense probably damaging 1.00
R4569:Ston2 UTSW 12 91639722 makesense probably null
R4864:Ston2 UTSW 12 91648674 missense possibly damaging 0.91
R6278:Ston2 UTSW 12 91648330 missense probably damaging 1.00
R6637:Ston2 UTSW 12 91714112 missense probably damaging 0.97
R6679:Ston2 UTSW 12 91648096 missense probably damaging 1.00
R7142:Ston2 UTSW 12 91647235 missense probably damaging 1.00
R8047:Ston2 UTSW 12 91641843 missense probably damaging 1.00
R8093:Ston2 UTSW 12 91743686 missense probably damaging 0.97
R8259:Ston2 UTSW 12 91641680 missense probably benign 0.02
X0064:Ston2 UTSW 12 91648905 missense possibly damaging 0.95
Z1088:Ston2 UTSW 12 91649067 missense possibly damaging 0.93
Z1177:Ston2 UTSW 12 91740630 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTGGTGCCCAGTTTAATTACC -3'
(R):5'- TGATGATCCTGATCCCGTCG -3'

Sequencing Primer
(F):5'- GTGGTGCCCAGTTTAATTACCTGTTC -3'
(R):5'- TGATCCCGTCGGCAATACAG -3'
Posted On2015-04-30