Incidental Mutation 'R4029:Gpr68'
ID313135
Institutional Source Beutler Lab
Gene Symbol Gpr68
Ensembl Gene ENSMUSG00000047415
Gene NameG protein-coupled receptor 68
SynonymsOGR1
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location100876682-100908198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100879216 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 23 (L23P)
Ref Sequence ENSEMBL: ENSMUSP00000105693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053668] [ENSMUST00000110065] [ENSMUST00000110066] [ENSMUST00000110070]
Predicted Effect probably damaging
Transcript: ENSMUST00000053668
AA Change: L23P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057510
Gene: ENSMUSG00000047415
AA Change: L23P

DomainStartEndE-ValueType
low complexity region 26 34 N/A INTRINSIC
Pfam:7tm_1 38 286 2.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110065
AA Change: L23P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105692
Gene: ENSMUSG00000047415
AA Change: L23P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 29 162 3e-6 PFAM
Pfam:7tm_1 38 286 1.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110066
AA Change: L23P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105693
Gene: ENSMUSG00000047415
AA Change: L23P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 29 162 3e-6 PFAM
Pfam:7tm_1 38 286 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110070
SMART Domains Protein: ENSMUSP00000105697
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 2.8e-51 PFAM
Pfam:DUF4392 298 563 2.5e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124957
SMART Domains Protein: ENSMUSP00000122512
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF4392 4 65 9.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135684
Meta Mutation Damage Score 0.7462 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor for sphingosylphosphorylcholine. The encoded protein is a proton-sensing receptor, inactive at pH 7.8 but active at pH 6.8. Mutations in this gene are a cause of amelogenesis imperfecta. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased osteoclastogenesis, abnormal pH-sensitive osteoclast survival, and background sensitive alterations in brown adipose tissue, monocytes, and macrophages. Mice homozygous for a different allele exhibit attenuated glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Gpr68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02368:Gpr68 APN 12 100878767 missense probably damaging 1.00
R0581:Gpr68 UTSW 12 100878556 missense probably damaging 1.00
R1800:Gpr68 UTSW 12 100878908 missense probably damaging 1.00
R1819:Gpr68 UTSW 12 100878403 missense possibly damaging 0.55
R1875:Gpr68 UTSW 12 100878790 missense probably damaging 1.00
R4030:Gpr68 UTSW 12 100879216 missense probably damaging 1.00
R4431:Gpr68 UTSW 12 100899391 unclassified probably benign
R5000:Gpr68 UTSW 12 100878337 missense probably benign 0.04
R5770:Gpr68 UTSW 12 100878821 missense probably benign 0.00
R6812:Gpr68 UTSW 12 100878411 missense probably damaging 1.00
R7217:Gpr68 UTSW 12 100878799 missense possibly damaging 0.91
R7567:Gpr68 UTSW 12 100878364 missense probably benign
R7814:Gpr68 UTSW 12 100879043 missense probably damaging 0.99
R7869:Gpr68 UTSW 12 100879238 missense probably benign 0.37
R7899:Gpr68 UTSW 12 100878448 missense probably damaging 1.00
X0018:Gpr68 UTSW 12 100878869 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAGAGGAGGATGCCACACAC -3'
(R):5'- TGATGCCTAGATCCTGATACATTTG -3'

Sequencing Primer
(F):5'- ATAGGTCACCATGGGACCAGTC -3'
(R):5'- AGATCCTGATACATTTGCATCACC -3'
Posted On2015-04-30