Incidental Mutation 'R4029:Ank'
ID313136
Institutional Source Beutler Lab
Gene Symbol Ank
Ensembl Gene ENSMUSG00000022265
Gene Nameprogressive ankylosis
SynonymsD15Ertd221e
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location27466677-27594909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27544257 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 35 (N35D)
Ref Sequence ENSEMBL: ENSMUSP00000022875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022875] [ENSMUST00000228179]
Predicted Effect probably damaging
Transcript: ENSMUST00000022875
AA Change: N35D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022875
Gene: ENSMUSG00000022265
AA Change: N35D

DomainStartEndE-ValueType
Pfam:ANKH 1 345 1e-223 PFAM
transmembrane domain 361 383 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228179
Meta Mutation Damage Score 0.9186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit joint stiffness due to increased calcium deposits in calcified cartilages and die prematurely. Hyperostosis of craniofacial bones and the mandible has been reported in other mutants as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Ank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ank APN 15 27544351 missense possibly damaging 0.53
IGL02975:Ank APN 15 27467001 utr 5 prime probably benign
R0309:Ank UTSW 15 27567572 missense possibly damaging 0.65
R0470:Ank UTSW 15 27571635 missense probably damaging 0.98
R1688:Ank UTSW 15 27557234 missense probably damaging 1.00
R1691:Ank UTSW 15 27590944 missense probably damaging 1.00
R2073:Ank UTSW 15 27565022 missense probably benign 0.20
R2248:Ank UTSW 15 27562711 splice site probably null
R3113:Ank UTSW 15 27571614 missense probably damaging 1.00
R4027:Ank UTSW 15 27544257 missense probably damaging 1.00
R4028:Ank UTSW 15 27544257 missense probably damaging 1.00
R4030:Ank UTSW 15 27544257 missense probably damaging 1.00
R4124:Ank UTSW 15 27571623 missense probably damaging 1.00
R4126:Ank UTSW 15 27590373 missense probably benign
R4508:Ank UTSW 15 27564977 missense probably damaging 1.00
R4517:Ank UTSW 15 27562749 missense possibly damaging 0.51
R4631:Ank UTSW 15 27467090 missense probably benign
R4653:Ank UTSW 15 27590361 missense probably null 0.98
R5001:Ank UTSW 15 27562733 missense probably damaging 0.99
R5029:Ank UTSW 15 27590353 missense probably benign 0.00
R5475:Ank UTSW 15 27557199 missense probably damaging 1.00
R7218:Ank UTSW 15 27544321 missense probably damaging 1.00
R7234:Ank UTSW 15 27571656 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTCAAACTGAAGCTAATGTGG -3'
(R):5'- ACCTATCAGGGTGTGGAAGAC -3'

Sequencing Primer
(F):5'- CTGAAGCTAATGTGGACAAAACC -3'
(R):5'- TGTGGAAGACGGCAGCG -3'
Posted On2015-04-30