Incidental Mutation 'R4029:Syt10'
ID313137
Institutional Source Beutler Lab
Gene Symbol Syt10
Ensembl Gene ENSMUSG00000063260
Gene Namesynaptotagmin X
Synonyms
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89782393-89841860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89814538 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 201 (E201G)
Ref Sequence ENSEMBL: ENSMUSP00000029441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029441]
Predicted Effect probably benign
Transcript: ENSMUST00000029441
AA Change: E201G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029441
Gene: ENSMUSG00000063260
AA Change: E201G

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
C2 247 350 1.22e-19 SMART
C2 379 493 7.73e-22 SMART
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit minor circadian rhythm impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Syt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Syt10 APN 15 89814079 missense probably damaging 1.00
IGL02976:Syt10 APN 15 89814479 missense probably benign 0.26
R0200:Syt10 UTSW 15 89826941 missense probably benign 0.01
R0306:Syt10 UTSW 15 89826988 missense probably benign 0.02
R0580:Syt10 UTSW 15 89827176 missense probably benign 0.15
R0608:Syt10 UTSW 15 89826941 missense probably benign 0.01
R1705:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1706:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1921:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1922:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2072:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2074:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2119:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2120:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2121:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R3812:Syt10 UTSW 15 89790797 missense probably benign
R4270:Syt10 UTSW 15 89790892 missense probably benign 0.39
R4536:Syt10 UTSW 15 89782622 missense probably damaging 0.99
R5333:Syt10 UTSW 15 89841729 missense probably benign 0.00
R6042:Syt10 UTSW 15 89841621 missense probably benign 0.13
R6104:Syt10 UTSW 15 89826864 missense probably benign 0.02
R6445:Syt10 UTSW 15 89814268 missense probably damaging 1.00
R6470:Syt10 UTSW 15 89792601 missense probably damaging 1.00
R6472:Syt10 UTSW 15 89814558 missense probably benign
R6679:Syt10 UTSW 15 89814371 missense probably damaging 1.00
R7048:Syt10 UTSW 15 89790805 missense probably damaging 1.00
R7128:Syt10 UTSW 15 89814111 missense probably damaging 1.00
R7315:Syt10 UTSW 15 89814338 missense probably damaging 0.99
R7352:Syt10 UTSW 15 89814456 missense probably benign 0.42
R7686:Syt10 UTSW 15 89814157 missense probably damaging 1.00
R7789:Syt10 UTSW 15 89826898 missense probably damaging 1.00
X0057:Syt10 UTSW 15 89826928 missense probably damaging 1.00
Z1088:Syt10 UTSW 15 89841639 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTGAAATCTTTAGCTGGGAG -3'
(R):5'- CCAAGGACAATGACACTTTTCTCC -3'

Sequencing Primer
(F):5'- TCTTTAGCTGGGAGATCTAAAGC -3'
(R):5'- AGGACAATGACACTTTTCTCCTGATC -3'
Posted On2015-04-30