Incidental Mutation 'R4029:Nme4'
ID313140
Institutional Source Beutler Lab
Gene Symbol Nme4
Ensembl Gene ENSMUSG00000024177
Gene NameNME/NM23 nucleoside diphosphate kinase 4
Synonyms2810024O08Rik, 2610027N22Rik, non-metastatic cells 4, protein expressed in, 5730493H09Rik, NM23-M4
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26091734-26095508 bp(-) (GRCm38)
Type of Mutationunclassified (4650 bp from exon)
DNA Base Change (assembly) T to C at 26094222 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025007] [ENSMUST00000040907] [ENSMUST00000053575]
Predicted Effect probably damaging
Transcript: ENSMUST00000025007
AA Change: D46G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025007
Gene: ENSMUSG00000024177
AA Change: D46G

DomainStartEndE-ValueType
NDK 36 173 4.09e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040907
SMART Domains Protein: ENSMUSP00000045621
Gene: ENSMUSG00000036775

DomainStartEndE-ValueType
Blast:NDK 1 28 5e-9 BLAST
Pfam:adh_short 29 224 3.6e-44 PFAM
Pfam:KR 30 208 3.8e-11 PFAM
Pfam:adh_short_C2 35 271 6.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053575
SMART Domains Protein: ENSMUSP00000137416
Gene: ENSMUSG00000049124

DomainStartEndE-ValueType
Sm 7 72 3.7e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150534
Meta Mutation Damage Score 0.9367 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dmrt2 T G 19: 25,678,134 S366A probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Nme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nme4 APN 17 26092062 missense probably benign 0.00
IGL01725:Nme4 APN 17 26092066 missense probably benign 0.05
IGL02217:Nme4 APN 17 26093860 missense probably damaging 0.99
R0153:Nme4 UTSW 17 26093857 critical splice donor site probably null
R1839:Nme4 UTSW 17 26092097 missense probably damaging 1.00
R2205:Nme4 UTSW 17 26092140 missense possibly damaging 0.95
R4027:Nme4 UTSW 17 26094222 unclassified probably null
R5023:Nme4 UTSW 17 26093668 missense probably benign 0.11
R5044:Nme4 UTSW 17 26093833 unclassified probably benign
R5635:Nme4 UTSW 17 26094231 missense probably damaging 1.00
R7873:Nme4 UTSW 17 26093888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACAACTCCAGAAGCTAG -3'
(R):5'- TCCACCTTGAGCAGCTTCTG -3'

Sequencing Primer
(F):5'- GCTAGCTCCTACAATGGATACCTC -3'
(R):5'- CCCTGAAAATGTGGAGCA -3'
Posted On2015-04-30