Incidental Mutation 'R4030:Akap3'
ID313167
Institutional Source Beutler Lab
Gene Symbol Akap3
Ensembl Gene ENSMUSG00000030344
Gene NameA kinase (PRKA) anchor protein 3
SynonymsAkap110; Sob1; Fsp95
Accession Numbers

NCBI RefSeq: NM_009650.2; MGI:1341149

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4030 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location126853098-126874308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126865021 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 201 (D201V)
Ref Sequence ENSEMBL: ENSMUSP00000143794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095440] [ENSMUST00000202574] [ENSMUST00000202878]
Predicted Effect probably damaging
Transcript: ENSMUST00000095440
AA Change: D201V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093091
Gene: ENSMUSG00000030344
AA Change: D201V

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202574
AA Change: D201V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144405
Gene: ENSMUSG00000030344
AA Change: D201V

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202878
AA Change: D201V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143794
Gene: ENSMUSG00000030344
AA Change: D201V

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,509 S54P probably benign Het
2700062C07Rik C T 18: 24,475,658 P145L probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Bpifb2 T C 2: 153,891,317 S400P probably benign Het
Brd7 A T 8: 88,332,931 I617N probably damaging Het
Cdhr2 C A 13: 54,717,861 P224Q probably damaging Het
Cdon A G 9: 35,491,906 N1104S probably damaging Het
Ceacam3 T C 7: 17,158,342 Y337H probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cpsf1 G A 15: 76,601,779 T397M possibly damaging Het
Crhr2 T C 6: 55,117,677 D32G probably benign Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dpyd A G 3: 118,897,166 D308G probably benign Het
Dsp A G 13: 38,191,428 N1063S possibly damaging Het
E030030I06Rik C A 10: 22,149,000 G5C unknown Het
Ehbp1 T C 11: 22,285,498 T32A probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbxo9 C A 9: 78,098,341 probably null Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch3 G A 4: 133,578,147 R231H possibly damaging Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
H2-Q6 C A 17: 35,425,816 Q194K probably benign Het
Hmgb1 A G 5: 149,050,700 M13T probably benign Het
Kdm5a T A 6: 120,405,113 L706* probably null Het
Krt12 A T 11: 99,422,028 F63L unknown Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Lgr4 T C 2: 109,989,751 S102P probably benign Het
Loxl4 A T 19: 42,608,359 V71E probably damaging Het
Lrrc36 A C 8: 105,426,807 N83T probably damaging Het
Med26 G A 8: 72,496,569 R229C probably damaging Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mkl1 G A 15: 81,015,784 T729I probably benign Het
Mroh8 T A 2: 157,213,720 D986V probably damaging Het
Mrpl49 T C 19: 6,055,200 D77G probably benign Het
Mrps30 T C 13: 118,380,541 N381D probably damaging Het
Olfr1248 C A 2: 89,617,863 V110F probably damaging Het
Omd T A 13: 49,589,649 N58K probably benign Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Plpp5 T A 8: 25,720,604 L74Q probably damaging Het
Prex2 T A 1: 11,208,568 Y1374N probably benign Het
Rbak A T 5: 143,173,969 I443K probably damaging Het
Rhpn1 A T 15: 75,710,557 S195C probably damaging Het
Rnf115 T A 3: 96,785,983 I210N probably damaging Het
Rock2 G A 12: 16,975,479 V1234I probably damaging Het
Scube2 A G 7: 109,831,771 V407A probably benign Het
Serpina3n G T 12: 104,411,401 probably null Het
Slco2b1 A G 7: 99,682,825 L283P probably damaging Het
Spag1 G A 15: 36,234,301 V736M probably damaging Het
Srebf2 T A 15: 82,178,783 C434S probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Trhr2 T C 8: 122,360,699 M1V probably null Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn2r105 T C 17: 20,208,754 R687G probably damaging Het
Vmn2r73 T C 7: 85,871,836 Y308C possibly damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zfyve9 A G 4: 108,719,701 V61A possibly damaging Het
Other mutations in Akap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Akap3 APN 6 126865731 missense probably benign 0.38
IGL01070:Akap3 APN 6 126865879 missense possibly damaging 0.93
IGL01975:Akap3 APN 6 126874000 missense probably damaging 1.00
IGL02114:Akap3 APN 6 126865996 missense probably damaging 0.99
IGL02349:Akap3 APN 6 126860263 missense probably benign 0.01
IGL03305:Akap3 APN 6 126864765 missense probably benign
IGL03412:Akap3 APN 6 126864725 missense probably benign 0.00
IGL03097:Akap3 UTSW 6 126866416 missense probably damaging 1.00
P0012:Akap3 UTSW 6 126864601 missense possibly damaging 0.87
R0358:Akap3 UTSW 6 126866812 missense probably damaging 1.00
R1123:Akap3 UTSW 6 126865966 missense probably benign 0.27
R1163:Akap3 UTSW 6 126864787 missense probably damaging 1.00
R1458:Akap3 UTSW 6 126865554 missense probably damaging 1.00
R1769:Akap3 UTSW 6 126865846 missense possibly damaging 0.67
R1967:Akap3 UTSW 6 126865098 missense probably benign 0.02
R4618:Akap3 UTSW 6 126866443 missense probably benign 0.31
R4677:Akap3 UTSW 6 126865263 missense probably damaging 0.99
R4735:Akap3 UTSW 6 126865638 missense probably damaging 1.00
R5660:Akap3 UTSW 6 126865291 missense probably damaging 1.00
R5834:Akap3 UTSW 6 126865833 missense probably benign 0.04
R5847:Akap3 UTSW 6 126865558 missense probably damaging 1.00
R6053:Akap3 UTSW 6 126866533 missense probably damaging 0.98
R7007:Akap3 UTSW 6 126866476 missense probably damaging 0.99
R7070:Akap3 UTSW 6 126874024 missense probably damaging 1.00
R7123:Akap3 UTSW 6 126866304 missense probably benign 0.05
R7173:Akap3 UTSW 6 126864766 missense probably benign
R7238:Akap3 UTSW 6 126865237 missense probably benign 0.00
R7437:Akap3 UTSW 6 126865655 missense probably damaging 1.00
R7731:Akap3 UTSW 6 126865068 missense probably benign 0.04
R7737:Akap3 UTSW 6 126874102 missense probably damaging 1.00
R8073:Akap3 UTSW 6 126865773 missense probably damaging 1.00
X0028:Akap3 UTSW 6 126865917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGAGAAGATCCACGGCG -3'
(R):5'- AGTCATCAGGCCTGTTGTCG -3'

Sequencing Primer
(F):5'- GCGCTGAAAACAAATGTGTCC -3'
(R):5'- AACAGTTTTTGATCTCCTGGTAAGG -3'
Posted On2015-04-30