Incidental Mutation 'R4030:Scube2'
ID 313171
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.633) question?
Stock # R4030 (G1)
Quality Score 208
Status Not validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109430978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 407 (V407A)
Ref Sequence ENSEMBL: ENSMUSP00000102339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably benign
Transcript: ENSMUST00000007423
AA Change: V407A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: V407A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
AA Change: V407A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: V407A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
AA Change: V407A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: V407A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,221,668 (GRCm39) S54P probably benign Het
2700062C07Rik C T 18: 24,608,715 (GRCm39) P145L probably benign Het
Akap3 A T 6: 126,841,984 (GRCm39) D201V probably damaging Het
Ank A G 15: 27,544,343 (GRCm39) N35D probably damaging Het
Bpifb2 T C 2: 153,733,237 (GRCm39) S400P probably benign Het
Brd7 A T 8: 89,059,559 (GRCm39) I617N probably damaging Het
Cdhr2 C A 13: 54,865,674 (GRCm39) P224Q probably damaging Het
Cdon A G 9: 35,403,202 (GRCm39) N1104S probably damaging Het
Ceacam3 T C 7: 16,892,267 (GRCm39) Y337H probably benign Het
Chrna5 T C 9: 54,905,370 (GRCm39) W61R probably damaging Het
Cntnap2 C A 6: 46,833,062 (GRCm39) F758L probably benign Het
Cpsf1 G A 15: 76,485,979 (GRCm39) T397M possibly damaging Het
Crhr2 T C 6: 55,094,662 (GRCm39) D32G probably benign Het
Dip2b A G 15: 100,084,053 (GRCm39) Y892C probably damaging Het
Dpyd A G 3: 118,690,815 (GRCm39) D308G probably benign Het
Dsp A G 13: 38,375,404 (GRCm39) N1063S possibly damaging Het
E030030I06Rik C A 10: 22,024,899 (GRCm39) G5C unknown Het
Ehbp1 T C 11: 22,235,498 (GRCm39) T32A probably damaging Het
Fbxo9 C A 9: 78,005,623 (GRCm39) probably null Het
Gpatch3 G A 4: 133,305,458 (GRCm39) R231H possibly damaging Het
Gpr68 A G 12: 100,845,475 (GRCm39) L23P probably damaging Het
H2-Q6 C A 17: 35,644,792 (GRCm39) Q194K probably benign Het
Hmgb1 A G 5: 148,987,510 (GRCm39) M13T probably benign Het
Kdm5a T A 6: 120,382,074 (GRCm39) L706* probably null Het
Krt12 A T 11: 99,312,854 (GRCm39) F63L unknown Het
Lefty1 T C 1: 180,765,346 (GRCm39) S305P probably benign Het
Lgr4 T C 2: 109,820,096 (GRCm39) S102P probably benign Het
Loxl4 A T 19: 42,596,798 (GRCm39) V71E probably damaging Het
Lrrc36 A C 8: 106,153,439 (GRCm39) N83T probably damaging Het
Med26 G A 8: 73,250,413 (GRCm39) R229C probably damaging Het
Mgam G A 6: 40,731,836 (GRCm39) R1351Q probably damaging Het
Mroh8 T A 2: 157,055,640 (GRCm39) D986V probably damaging Het
Mrpl49 T C 19: 6,105,230 (GRCm39) D77G probably benign Het
Mrps30 T C 13: 118,517,077 (GRCm39) N381D probably damaging Het
Mrtfa G A 15: 80,899,985 (GRCm39) T729I probably benign Het
Omd T A 13: 49,743,125 (GRCm39) N58K probably benign Het
Oog4 A T 4: 143,166,770 (GRCm39) N11K probably benign Het
Or4a75 C A 2: 89,448,207 (GRCm39) V110F probably damaging Het
Plpp5 T A 8: 26,210,631 (GRCm39) L74Q probably damaging Het
Pramel28 T A 4: 143,692,354 (GRCm39) T216S probably benign Het
Prex2 T A 1: 11,278,792 (GRCm39) Y1374N probably benign Het
Rbak A T 5: 143,159,724 (GRCm39) I443K probably damaging Het
Rhpn1 A T 15: 75,582,406 (GRCm39) S195C probably damaging Het
Rnf115 T A 3: 96,693,299 (GRCm39) I210N probably damaging Het
Rock2 G A 12: 17,025,480 (GRCm39) V1234I probably damaging Het
Serpina3n G T 12: 104,377,660 (GRCm39) probably null Het
Shisal2a G T 4: 108,240,412 (GRCm39) C43* probably null Het
Slco2b1 A G 7: 99,332,032 (GRCm39) L283P probably damaging Het
Spag1 G A 15: 36,234,447 (GRCm39) V736M probably damaging Het
Srebf2 T A 15: 82,062,984 (GRCm39) C434S probably damaging Het
Ston2 T C 12: 91,615,037 (GRCm39) Q457R possibly damaging Het
Trhr2 T C 8: 123,087,438 (GRCm39) M1V probably null Het
Tshz1 T C 18: 84,032,954 (GRCm39) K485E possibly damaging Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Vmn2r105 T C 17: 20,429,016 (GRCm39) R687G probably damaging Het
Vmn2r73 T C 7: 85,521,044 (GRCm39) Y308C possibly damaging Het
Wdr49 C A 3: 75,230,972 (GRCm39) L563F probably benign Het
Zfyve9 A G 4: 108,576,898 (GRCm39) V61A possibly damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109,432,220 (GRCm39) nonsense probably null
R6731:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8273:Scube2 UTSW 7 109,408,383 (GRCm39) missense probably benign 0.00
R8427:Scube2 UTSW 7 109,399,797 (GRCm39) missense probably damaging 1.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9709:Scube2 UTSW 7 109,430,971 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGGCCCAGTGGAGTATGC -3'
(R):5'- GGTTAAAACTCTCAACCAAGGC -3'

Sequencing Primer
(F):5'- TGGAGTATGCAAGCACACAGTCTC -3'
(R):5'- GTTAAAACTCTCAACCAAGGCACATG -3'
Posted On 2015-04-30