Incidental Mutation 'R4030:Ehbp1'
ID313184
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene NameEH domain binding protein 1
SynonymsKIAA0903-like, Flj21950
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R4030 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location22005828-22342292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22285498 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 32 (T32A)
Ref Sequence ENSEMBL: ENSMUSP00000136697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000134293] [ENSMUST00000180360]
Predicted Effect probably damaging
Transcript: ENSMUST00000045167
AA Change: T32A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: T32A

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109563
AA Change: T32A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: T32A

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134293
AA Change: T32A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118583
Gene: ENSMUSG00000042302
AA Change: T32A

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.5e-33 PFAM
low complexity region 185 205 N/A INTRINSIC
Blast:DUF3585 206 250 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137594
Predicted Effect probably damaging
Transcript: ENSMUST00000180360
AA Change: T32A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: T32A

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,509 S54P probably benign Het
2700062C07Rik C T 18: 24,475,658 P145L probably benign Het
Akap3 A T 6: 126,865,021 D201V probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Bpifb2 T C 2: 153,891,317 S400P probably benign Het
Brd7 A T 8: 88,332,931 I617N probably damaging Het
Cdhr2 C A 13: 54,717,861 P224Q probably damaging Het
Cdon A G 9: 35,491,906 N1104S probably damaging Het
Ceacam3 T C 7: 17,158,342 Y337H probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cpsf1 G A 15: 76,601,779 T397M possibly damaging Het
Crhr2 T C 6: 55,117,677 D32G probably benign Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dpyd A G 3: 118,897,166 D308G probably benign Het
Dsp A G 13: 38,191,428 N1063S possibly damaging Het
E030030I06Rik C A 10: 22,149,000 G5C unknown Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbxo9 C A 9: 78,098,341 probably null Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch3 G A 4: 133,578,147 R231H possibly damaging Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
H2-Q6 C A 17: 35,425,816 Q194K probably benign Het
Hmgb1 A G 5: 149,050,700 M13T probably benign Het
Kdm5a T A 6: 120,405,113 L706* probably null Het
Krt12 A T 11: 99,422,028 F63L unknown Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Lgr4 T C 2: 109,989,751 S102P probably benign Het
Loxl4 A T 19: 42,608,359 V71E probably damaging Het
Lrrc36 A C 8: 105,426,807 N83T probably damaging Het
Med26 G A 8: 72,496,569 R229C probably damaging Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mkl1 G A 15: 81,015,784 T729I probably benign Het
Mroh8 T A 2: 157,213,720 D986V probably damaging Het
Mrpl49 T C 19: 6,055,200 D77G probably benign Het
Mrps30 T C 13: 118,380,541 N381D probably damaging Het
Olfr1248 C A 2: 89,617,863 V110F probably damaging Het
Omd T A 13: 49,589,649 N58K probably benign Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Plpp5 T A 8: 25,720,604 L74Q probably damaging Het
Prex2 T A 1: 11,208,568 Y1374N probably benign Het
Rbak A T 5: 143,173,969 I443K probably damaging Het
Rhpn1 A T 15: 75,710,557 S195C probably damaging Het
Rnf115 T A 3: 96,785,983 I210N probably damaging Het
Rock2 G A 12: 16,975,479 V1234I probably damaging Het
Scube2 A G 7: 109,831,771 V407A probably benign Het
Serpina3n G T 12: 104,411,401 probably null Het
Slco2b1 A G 7: 99,682,825 L283P probably damaging Het
Spag1 G A 15: 36,234,301 V736M probably damaging Het
Srebf2 T A 15: 82,178,783 C434S probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Trhr2 T C 8: 122,360,699 M1V probably null Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn2r105 T C 17: 20,208,754 R687G probably damaging Het
Vmn2r73 T C 7: 85,871,836 Y308C possibly damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zfyve9 A G 4: 108,719,701 V61A possibly damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22247967 splice site probably benign
IGL00786:Ehbp1 APN 11 22100460 missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22138022 missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22089636 missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22095611 missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22172883 missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22089584 missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22101115 missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22101218 missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22285486 critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22096048 missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22089653 missense probably damaging 1.00
trajan UTSW 11 22151850 missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22089683 splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22053494 missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22231992 splice site probably benign
R0294:Ehbp1 UTSW 11 22095427 missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22095886 missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22151836 missense probably benign
R0468:Ehbp1 UTSW 11 22169184 splice site probably benign
R0943:Ehbp1 UTSW 11 22095883 missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22062831 missense probably benign 0.25
R1481:Ehbp1 UTSW 11 22006782 makesense probably null
R1493:Ehbp1 UTSW 11 22006866 missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22059231 missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22096000 missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22146694 missense probably benign
R1696:Ehbp1 UTSW 11 22053441 missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22151850 missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22059228 missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22095462 missense probably benign
R2436:Ehbp1 UTSW 11 22089524 critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22100465 missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R4085:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22151843 missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22095892 missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22239169 missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22101073 missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22095370 missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22137846 missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22151887 missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22239156 missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22285684 start gained probably benign
R6685:Ehbp1 UTSW 11 22146641 missense probably benign 0.01
R6893:Ehbp1 UTSW 11 22014945 missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22053529 nonsense probably null
R7465:Ehbp1 UTSW 11 22138001 missense probably benign
R7722:Ehbp1 UTSW 11 22089572 missense probably null
R7724:Ehbp1 UTSW 11 22089572 missense probably null
X0018:Ehbp1 UTSW 11 22101085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGAGACGATCTGAAATGGAG -3'
(R):5'- ACATACATGCAAGGCTCGTG -3'

Sequencing Primer
(F):5'- GTGATTAAAATCCACAGAGACAGTAC -3'
(R):5'- CAAGGCTCGTGTGCTTTATCAAAG -3'
Posted On2015-04-30