Incidental Mutation 'R4030:Srebf2'
ID313201
Institutional Source Beutler Lab
Gene Symbol Srebf2
Ensembl Gene ENSMUSG00000022463
Gene Namesterol regulatory element binding factor 2
Synonymsnuc, bHLHd2, lop13, SREBP-2, SREBP2gc, SREBP2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4030 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82147181-82205379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82178783 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 434 (C434S)
Ref Sequence ENSEMBL: ENSMUSP00000155022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000229336]
Predicted Effect probably damaging
Transcript: ENSMUST00000023100
AA Change: C474S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463
AA Change: C474S

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 118 137 N/A INTRINSIC
low complexity region 178 204 N/A INTRINSIC
low complexity region 210 235 N/A INTRINSIC
HLH 325 375 3.54e-15 SMART
low complexity region 383 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229336
AA Change: C434S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230105
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display prenatal lethality. Mice homozygous for an ENU mutation display cataracts and persistent wounds of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,509 S54P probably benign Het
2700062C07Rik C T 18: 24,475,658 P145L probably benign Het
Akap3 A T 6: 126,865,021 D201V probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Bpifb2 T C 2: 153,891,317 S400P probably benign Het
Brd7 A T 8: 88,332,931 I617N probably damaging Het
Cdhr2 C A 13: 54,717,861 P224Q probably damaging Het
Cdon A G 9: 35,491,906 N1104S probably damaging Het
Ceacam3 T C 7: 17,158,342 Y337H probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cpsf1 G A 15: 76,601,779 T397M possibly damaging Het
Crhr2 T C 6: 55,117,677 D32G probably benign Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dpyd A G 3: 118,897,166 D308G probably benign Het
Dsp A G 13: 38,191,428 N1063S possibly damaging Het
E030030I06Rik C A 10: 22,149,000 G5C unknown Het
Ehbp1 T C 11: 22,285,498 T32A probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbxo9 C A 9: 78,098,341 probably null Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch3 G A 4: 133,578,147 R231H possibly damaging Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
H2-Q6 C A 17: 35,425,816 Q194K probably benign Het
Hmgb1 A G 5: 149,050,700 M13T probably benign Het
Kdm5a T A 6: 120,405,113 L706* probably null Het
Krt12 A T 11: 99,422,028 F63L unknown Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Lgr4 T C 2: 109,989,751 S102P probably benign Het
Loxl4 A T 19: 42,608,359 V71E probably damaging Het
Lrrc36 A C 8: 105,426,807 N83T probably damaging Het
Med26 G A 8: 72,496,569 R229C probably damaging Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mkl1 G A 15: 81,015,784 T729I probably benign Het
Mroh8 T A 2: 157,213,720 D986V probably damaging Het
Mrpl49 T C 19: 6,055,200 D77G probably benign Het
Mrps30 T C 13: 118,380,541 N381D probably damaging Het
Olfr1248 C A 2: 89,617,863 V110F probably damaging Het
Omd T A 13: 49,589,649 N58K probably benign Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Plpp5 T A 8: 25,720,604 L74Q probably damaging Het
Prex2 T A 1: 11,208,568 Y1374N probably benign Het
Rbak A T 5: 143,173,969 I443K probably damaging Het
Rhpn1 A T 15: 75,710,557 S195C probably damaging Het
Rnf115 T A 3: 96,785,983 I210N probably damaging Het
Rock2 G A 12: 16,975,479 V1234I probably damaging Het
Scube2 A G 7: 109,831,771 V407A probably benign Het
Serpina3n G T 12: 104,411,401 probably null Het
Slco2b1 A G 7: 99,682,825 L283P probably damaging Het
Spag1 G A 15: 36,234,301 V736M probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Trhr2 T C 8: 122,360,699 M1V probably null Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn2r105 T C 17: 20,208,754 R687G probably damaging Het
Vmn2r73 T C 7: 85,871,836 Y308C possibly damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zfyve9 A G 4: 108,719,701 V61A possibly damaging Het
Other mutations in Srebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Srebf2 APN 15 82192203 unclassified probably benign
IGL01409:Srebf2 APN 15 82171218 missense probably damaging 1.00
IGL01415:Srebf2 APN 15 82177462 missense probably benign 0.08
IGL01614:Srebf2 APN 15 82178853 missense probably benign
IGL01985:Srebf2 APN 15 82192359 missense probably benign 0.01
IGL02423:Srebf2 APN 15 82175097 missense probably damaging 1.00
IGL02436:Srebf2 APN 15 82197727 missense probably benign 0.41
IGL02805:Srebf2 APN 15 82169844 missense probably benign 0.00
IGL02818:Srebf2 APN 15 82185374 missense probably damaging 0.99
IGL02823:Srebf2 APN 15 82199774 missense possibly damaging 0.87
IGL02895:Srebf2 APN 15 82147467 missense possibly damaging 0.72
IGL03064:Srebf2 APN 15 82192222 missense probably benign 0.01
IGL03378:Srebf2 APN 15 82169788 missense probably damaging 1.00
FR4449:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4548:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4737:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4976:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
R0230:Srebf2 UTSW 15 82182085 missense probably damaging 1.00
R0702:Srebf2 UTSW 15 82177409 missense probably damaging 1.00
R0829:Srebf2 UTSW 15 82177589 critical splice donor site probably null
R1241:Srebf2 UTSW 15 82177519 missense probably damaging 1.00
R1898:Srebf2 UTSW 15 82203735 missense probably damaging 1.00
R1957:Srebf2 UTSW 15 82194954 missense probably benign 0.26
R2395:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R3771:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3772:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3773:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R4613:Srebf2 UTSW 15 82185348 missense possibly damaging 0.94
R4670:Srebf2 UTSW 15 82192302 missense probably damaging 1.00
R4758:Srebf2 UTSW 15 82196169 missense probably benign 0.01
R4812:Srebf2 UTSW 15 82203825 missense probably damaging 0.98
R5058:Srebf2 UTSW 15 82182050 missense probably damaging 0.99
R5063:Srebf2 UTSW 15 82177451 missense probably benign
R5155:Srebf2 UTSW 15 82196226 missense probably damaging 1.00
R5166:Srebf2 UTSW 15 82185402 missense probably damaging 1.00
R5330:Srebf2 UTSW 15 82196208 missense possibly damaging 0.88
R5398:Srebf2 UTSW 15 82171242 missense probably damaging 1.00
R5662:Srebf2 UTSW 15 82195003 missense probably benign 0.01
R5668:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R5867:Srebf2 UTSW 15 82169786 missense probably damaging 1.00
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6928:Srebf2 UTSW 15 82203723 nonsense probably null
R7269:Srebf2 UTSW 15 82204069 missense probably benign 0.00
R7464:Srebf2 UTSW 15 82172874 missense probably damaging 0.97
R7632:Srebf2 UTSW 15 82185296 missense probably benign
R7831:Srebf2 UTSW 15 82182087 missense probably damaging 0.98
R7895:Srebf2 UTSW 15 82177240 missense probably benign 0.02
R7938:Srebf2 UTSW 15 82172815 missense probably damaging 1.00
R7974:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R7991:Srebf2 UTSW 15 82204052 missense probably damaging 1.00
R8002:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R8022:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R8137:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R8138:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R8139:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
X0064:Srebf2 UTSW 15 82175220 missense probably damaging 1.00
Z1088:Srebf2 UTSW 15 82194921 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGAAACATGTGGTTCGTTAGTATC -3'
(R):5'- ACAGGGTCCTTTTGCCACAG -3'

Sequencing Primer
(F):5'- TAGAATGAACTCTGTCGGCC -3'
(R):5'- ACAGCAGGCCACCCAAC -3'
Posted On2015-04-30