Incidental Mutation 'R4030:Dip2b'
ID 313202
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R4030 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100084053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 892 (Y892C)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: Y658C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: Y658C

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: Y892C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: Y892C

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: Y658C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: Y658C

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229080
Meta Mutation Damage Score 0.6102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,221,668 (GRCm39) S54P probably benign Het
2700062C07Rik C T 18: 24,608,715 (GRCm39) P145L probably benign Het
Akap3 A T 6: 126,841,984 (GRCm39) D201V probably damaging Het
Ank A G 15: 27,544,343 (GRCm39) N35D probably damaging Het
Bpifb2 T C 2: 153,733,237 (GRCm39) S400P probably benign Het
Brd7 A T 8: 89,059,559 (GRCm39) I617N probably damaging Het
Cdhr2 C A 13: 54,865,674 (GRCm39) P224Q probably damaging Het
Cdon A G 9: 35,403,202 (GRCm39) N1104S probably damaging Het
Ceacam3 T C 7: 16,892,267 (GRCm39) Y337H probably benign Het
Chrna5 T C 9: 54,905,370 (GRCm39) W61R probably damaging Het
Cntnap2 C A 6: 46,833,062 (GRCm39) F758L probably benign Het
Cpsf1 G A 15: 76,485,979 (GRCm39) T397M possibly damaging Het
Crhr2 T C 6: 55,094,662 (GRCm39) D32G probably benign Het
Dpyd A G 3: 118,690,815 (GRCm39) D308G probably benign Het
Dsp A G 13: 38,375,404 (GRCm39) N1063S possibly damaging Het
E030030I06Rik C A 10: 22,024,899 (GRCm39) G5C unknown Het
Ehbp1 T C 11: 22,235,498 (GRCm39) T32A probably damaging Het
Fbxo9 C A 9: 78,005,623 (GRCm39) probably null Het
Gpatch3 G A 4: 133,305,458 (GRCm39) R231H possibly damaging Het
Gpr68 A G 12: 100,845,475 (GRCm39) L23P probably damaging Het
H2-Q6 C A 17: 35,644,792 (GRCm39) Q194K probably benign Het
Hmgb1 A G 5: 148,987,510 (GRCm39) M13T probably benign Het
Kdm5a T A 6: 120,382,074 (GRCm39) L706* probably null Het
Krt12 A T 11: 99,312,854 (GRCm39) F63L unknown Het
Lefty1 T C 1: 180,765,346 (GRCm39) S305P probably benign Het
Lgr4 T C 2: 109,820,096 (GRCm39) S102P probably benign Het
Loxl4 A T 19: 42,596,798 (GRCm39) V71E probably damaging Het
Lrrc36 A C 8: 106,153,439 (GRCm39) N83T probably damaging Het
Med26 G A 8: 73,250,413 (GRCm39) R229C probably damaging Het
Mgam G A 6: 40,731,836 (GRCm39) R1351Q probably damaging Het
Mroh8 T A 2: 157,055,640 (GRCm39) D986V probably damaging Het
Mrpl49 T C 19: 6,105,230 (GRCm39) D77G probably benign Het
Mrps30 T C 13: 118,517,077 (GRCm39) N381D probably damaging Het
Mrtfa G A 15: 80,899,985 (GRCm39) T729I probably benign Het
Omd T A 13: 49,743,125 (GRCm39) N58K probably benign Het
Oog4 A T 4: 143,166,770 (GRCm39) N11K probably benign Het
Or4a75 C A 2: 89,448,207 (GRCm39) V110F probably damaging Het
Plpp5 T A 8: 26,210,631 (GRCm39) L74Q probably damaging Het
Pramel28 T A 4: 143,692,354 (GRCm39) T216S probably benign Het
Prex2 T A 1: 11,278,792 (GRCm39) Y1374N probably benign Het
Rbak A T 5: 143,159,724 (GRCm39) I443K probably damaging Het
Rhpn1 A T 15: 75,582,406 (GRCm39) S195C probably damaging Het
Rnf115 T A 3: 96,693,299 (GRCm39) I210N probably damaging Het
Rock2 G A 12: 17,025,480 (GRCm39) V1234I probably damaging Het
Scube2 A G 7: 109,430,978 (GRCm39) V407A probably benign Het
Serpina3n G T 12: 104,377,660 (GRCm39) probably null Het
Shisal2a G T 4: 108,240,412 (GRCm39) C43* probably null Het
Slco2b1 A G 7: 99,332,032 (GRCm39) L283P probably damaging Het
Spag1 G A 15: 36,234,447 (GRCm39) V736M probably damaging Het
Srebf2 T A 15: 82,062,984 (GRCm39) C434S probably damaging Het
Ston2 T C 12: 91,615,037 (GRCm39) Q457R possibly damaging Het
Trhr2 T C 8: 123,087,438 (GRCm39) M1V probably null Het
Tshz1 T C 18: 84,032,954 (GRCm39) K485E possibly damaging Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Vmn2r105 T C 17: 20,429,016 (GRCm39) R687G probably damaging Het
Vmn2r73 T C 7: 85,521,044 (GRCm39) Y308C possibly damaging Het
Wdr49 C A 3: 75,230,972 (GRCm39) L563F probably benign Het
Zfyve9 A G 4: 108,576,898 (GRCm39) V61A possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTCAAGTATACCTTGCAGG -3'
(R):5'- TCAGTCTTGCAGAGTCCACG -3'

Sequencing Primer
(F):5'- CCTTGCAGGTGGTAGCAG -3'
(R):5'- GAAGCCACATTATTACCTGGTTGC -3'
Posted On 2015-04-30