Incidental Mutation 'R4030:Tshz1'
ID313205
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Nameteashirt zinc finger family member 1
SynonymsMtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4030 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location84011627-84086404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84014829 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 485 (K485E)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060303
AA Change: K485E

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: K485E

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175783
SMART Domains Protein: ENSMUSP00000135640
Gene: ENSMUSG00000046982

DomainStartEndE-ValueType
ZnF_C2H2 43 67 1.7e-4 SMART
ZnF_C2H2 152 176 2.3e-2 SMART
low complexity region 233 251 N/A INTRINSIC
HOX 626 700 2.1e-6 SMART
ZnF_C2H2 712 734 1.9e-3 SMART
ZnF_C2H2 780 803 1.8e-5 SMART
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,509 S54P probably benign Het
2700062C07Rik C T 18: 24,475,658 P145L probably benign Het
Akap3 A T 6: 126,865,021 D201V probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Bpifb2 T C 2: 153,891,317 S400P probably benign Het
Brd7 A T 8: 88,332,931 I617N probably damaging Het
Cdhr2 C A 13: 54,717,861 P224Q probably damaging Het
Cdon A G 9: 35,491,906 N1104S probably damaging Het
Ceacam3 T C 7: 17,158,342 Y337H probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cpsf1 G A 15: 76,601,779 T397M possibly damaging Het
Crhr2 T C 6: 55,117,677 D32G probably benign Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dpyd A G 3: 118,897,166 D308G probably benign Het
Dsp A G 13: 38,191,428 N1063S possibly damaging Het
E030030I06Rik C A 10: 22,149,000 G5C unknown Het
Ehbp1 T C 11: 22,285,498 T32A probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbxo9 C A 9: 78,098,341 probably null Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch3 G A 4: 133,578,147 R231H possibly damaging Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
H2-Q6 C A 17: 35,425,816 Q194K probably benign Het
Hmgb1 A G 5: 149,050,700 M13T probably benign Het
Kdm5a T A 6: 120,405,113 L706* probably null Het
Krt12 A T 11: 99,422,028 F63L unknown Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Lgr4 T C 2: 109,989,751 S102P probably benign Het
Loxl4 A T 19: 42,608,359 V71E probably damaging Het
Lrrc36 A C 8: 105,426,807 N83T probably damaging Het
Med26 G A 8: 72,496,569 R229C probably damaging Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mkl1 G A 15: 81,015,784 T729I probably benign Het
Mroh8 T A 2: 157,213,720 D986V probably damaging Het
Mrpl49 T C 19: 6,055,200 D77G probably benign Het
Mrps30 T C 13: 118,380,541 N381D probably damaging Het
Olfr1248 C A 2: 89,617,863 V110F probably damaging Het
Omd T A 13: 49,589,649 N58K probably benign Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Plpp5 T A 8: 25,720,604 L74Q probably damaging Het
Prex2 T A 1: 11,208,568 Y1374N probably benign Het
Rbak A T 5: 143,173,969 I443K probably damaging Het
Rhpn1 A T 15: 75,710,557 S195C probably damaging Het
Rnf115 T A 3: 96,785,983 I210N probably damaging Het
Rock2 G A 12: 16,975,479 V1234I probably damaging Het
Scube2 A G 7: 109,831,771 V407A probably benign Het
Serpina3n G T 12: 104,411,401 probably null Het
Slco2b1 A G 7: 99,682,825 L283P probably damaging Het
Spag1 G A 15: 36,234,301 V736M probably damaging Het
Srebf2 T A 15: 82,178,783 C434S probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Trhr2 T C 8: 122,360,699 M1V probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn2r105 T C 17: 20,208,754 R687G probably damaging Het
Vmn2r73 T C 7: 85,871,836 Y308C possibly damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zfyve9 A G 4: 108,719,701 V61A possibly damaging Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R0943:Tshz1 UTSW 18 84015231 missense probably benign 0.04
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R5778:Tshz1 UTSW 18 84015680 missense probably damaging 1.00
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6425:Tshz1 UTSW 18 84015563 missense probably damaging 0.99
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7330:Tshz1 UTSW 18 84014831 missense probably damaging 0.96
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7592:Tshz1 UTSW 18 84014048 missense probably damaging 1.00
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7927:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7989:Tshz1 UTSW 18 84014607 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTAGGTCTTCCTCACGCAG -3'
(R):5'- ACTCAAGTGCATGGAATGTGG -3'

Sequencing Primer
(F):5'- GGTACTGATAAAGGGCAGTGG -3'
(R):5'- GAATGTGGCAGCTCCCATGATAC -3'
Posted On2015-04-30