Incidental Mutation 'R4021:Fam107b'
ID 313210
Institutional Source Beutler Lab
Gene Symbol Fam107b
Ensembl Gene ENSMUSG00000026655
Gene Name family with sequence similarity 107, member B
Synonyms 3110001A13Rik
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 3705049-3783179 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3779511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 238 (R238Q)
Ref Sequence ENSEMBL: ENSMUSP00000154419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027965] [ENSMUST00000115052] [ENSMUST00000115053] [ENSMUST00000115054] [ENSMUST00000115055] [ENSMUST00000176254] [ENSMUST00000177125] [ENSMUST00000226435]
AlphaFold Q3TGF2
Predicted Effect possibly damaging
Transcript: ENSMUST00000027965
AA Change: R62Q

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027965
Gene: ENSMUSG00000026655
AA Change: R62Q

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115052
AA Change: R84Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110704
Gene: ENSMUSG00000026655
AA Change: R84Q

DomainStartEndE-ValueType
Pfam:DUF1151 29 142 3.4e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115053
AA Change: R62Q

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110705
Gene: ENSMUSG00000026655
AA Change: R62Q

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115054
AA Change: R62Q

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110706
Gene: ENSMUSG00000026655
AA Change: R62Q

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115055
AA Change: R62Q

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110707
Gene: ENSMUSG00000026655
AA Change: R62Q

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176254
AA Change: R6Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135846
Gene: ENSMUSG00000026655
AA Change: R6Q

DomainStartEndE-ValueType
Pfam:DUF1151 1 64 2.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177125
Predicted Effect probably damaging
Transcript: ENSMUST00000226435
AA Change: R238Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.2758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Farsa A G 8: 85,595,499 (GRCm39) T465A probably damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Got2 T G 8: 96,604,381 (GRCm39) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Hexd T C 11: 121,108,987 (GRCm39) probably null Het
Igf2r T A 17: 12,967,638 (GRCm39) N27I probably damaging Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lair1 A G 7: 4,058,915 (GRCm39) probably null Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mroh2b T A 15: 4,954,582 (GRCm39) C682S possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Fam107b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Fam107b APN 2 3,779,565 (GRCm39) missense probably damaging 1.00
IGL03377:Fam107b APN 2 3,779,481 (GRCm39) missense probably damaging 1.00
R4234:Fam107b UTSW 2 3,771,777 (GRCm39) missense possibly damaging 0.67
R4841:Fam107b UTSW 2 3,779,580 (GRCm39) missense probably damaging 1.00
R4842:Fam107b UTSW 2 3,779,580 (GRCm39) missense probably damaging 1.00
R4938:Fam107b UTSW 2 3,773,907 (GRCm39) missense probably benign 0.00
R5557:Fam107b UTSW 2 3,771,791 (GRCm39) nonsense probably null
R5754:Fam107b UTSW 2 3,779,457 (GRCm39) missense probably damaging 1.00
R5892:Fam107b UTSW 2 3,779,601 (GRCm39) missense probably damaging 1.00
R5996:Fam107b UTSW 2 3,780,667 (GRCm39) splice site probably null
R7634:Fam107b UTSW 2 3,771,777 (GRCm39) missense possibly damaging 0.67
R7652:Fam107b UTSW 2 3,773,884 (GRCm39) missense probably benign 0.00
R7664:Fam107b UTSW 2 3,571,747 (GRCm39) missense probably damaging 0.98
R7672:Fam107b UTSW 2 3,773,959 (GRCm39) missense probably damaging 1.00
X0027:Fam107b UTSW 2 3,779,504 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTTCCAGGCAGTAAGTGTC -3'
(R):5'- CCTGCTGGAATTCTGCTTGC -3'

Sequencing Primer
(F):5'- AGCAGTAGATACTCTCCTCTGG -3'
(R):5'- GGAATTCTGCTTGCCTGGCATC -3'
Posted On 2015-04-30