Mutagenetix > Incidental Mutation

Incidental Mutation 'R4021:Cdh22'

313216

Institutional Source

Beutler Lab

Gene Symbol

Cdh22

Ensembl Gene

ENSMUSG00000053166

Gene Name

cadherin 22

Synonyms

PB-cadherin

MMRRC Submission

040955-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

165111507-165234853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 165143673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 331 (D331G)

Ref Sequence

ENSEMBL: ENSMUSP00000120785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]

AlphaFold

Q9WTP5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065438
AA Change: D331G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: D331G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
CA	82	163	2.19e-16	SMART
CA	187	272	3.11e-30	SMART
CA	296	390	4.88e-14	SMART
CA	413	494	2.27e-23	SMART
CA	517	604	4.52e-9	SMART
transmembrane domain	622	644	N/A	INTRINSIC
Pfam:Cadherin_C	647	803	4.3e-46	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138643
AA Change: D331G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: D331G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
CA	82	163	2.19e-16	SMART
CA	187	272	3.11e-30	SMART
CA	296	390	4.88e-14	SMART

Meta Mutation Damage Score

0.1042

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cacna2d2	C	T	9: 107,514,058	T428M	probably damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Itgax	T	A	7: 128,133,139		probably null	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lair1	A	G	7: 4,055,916		probably null	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mroh2b	T	A	15: 4,925,100	C682S	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Cdh22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cdh22	APN	2	165112601	missense	possibly damaging	0.54
IGL01868:Cdh22	APN	2	165157358	missense	probably damaging	0.99
IGL01932:Cdh22	APN	2	165170808	missense	probably benign	0.05
IGL02268:Cdh22	APN	2	165123719	splice site	probably benign
IGL02455:Cdh22	APN	2	165142255	missense	possibly damaging	0.46
IGL03231:Cdh22	APN	2	165116206	missense	probably benign	0.16
IGL03264:Cdh22	APN	2	165116173	missense	probably benign	0.21
IGL03014:Cdh22	UTSW	2	165112411	nonsense	probably null
R0712:Cdh22	UTSW	2	165170656	missense	probably damaging	1.00
R0865:Cdh22	UTSW	2	165181056	missense	probably damaging	0.98
R1192:Cdh22	UTSW	2	165135283	missense	probably damaging	1.00
R1700:Cdh22	UTSW	2	165170796	missense	probably damaging	1.00
R1844:Cdh22	UTSW	2	165143694	missense	probably damaging	1.00
R2005:Cdh22	UTSW	2	165180923	missense	probably damaging	1.00
R2137:Cdh22	UTSW	2	165116394	splice site	probably benign
R2270:Cdh22	UTSW	2	165143847	splice site	probably null
R2271:Cdh22	UTSW	2	165143847	splice site	probably null
R2272:Cdh22	UTSW	2	165143847	splice site	probably null
R4022:Cdh22	UTSW	2	165157253	missense	probably benign	0.14
R4613:Cdh22	UTSW	2	165143656	missense	probably benign
R4625:Cdh22	UTSW	2	165112606	missense	probably damaging	1.00
R5038:Cdh22	UTSW	2	165142277	missense	probably benign	0.16
R5057:Cdh22	UTSW	2	165116143	missense	probably damaging	0.98
R5649:Cdh22	UTSW	2	165116280	missense	probably damaging	1.00
R6175:Cdh22	UTSW	2	165146630	missense	probably damaging	0.98
R6297:Cdh22	UTSW	2	165143644	missense	possibly damaging	0.86
R6445:Cdh22	UTSW	2	165170692	missense	probably damaging	0.97
R7294:Cdh22	UTSW	2	165142093	missense	possibly damaging	0.94
R7310:Cdh22	UTSW	2	165112294	nonsense	probably null
R7595:Cdh22	UTSW	2	165112463	missense	probably benign	0.00
R7601:Cdh22	UTSW	2	165112546	missense	probably damaging	1.00
R8047:Cdh22	UTSW	2	165170767	missense	probably damaging	1.00
R8308:Cdh22	UTSW	2	165112178	missense	probably damaging	0.99
R8480:Cdh22	UTSW	2	165146726	missense	probably benign
R8526:Cdh22	UTSW	2	165112258	missense	probably damaging	1.00
R8771:Cdh22	UTSW	2	165146769	missense	possibly damaging	0.94
R8927:Cdh22	UTSW	2	165123584	missense	possibly damaging	0.58
R8928:Cdh22	UTSW	2	165123584	missense	possibly damaging	0.58
R9158:Cdh22	UTSW	2	165170707	missense	probably damaging	1.00
R9433:Cdh22	UTSW	2	165112409	missense	probably benign	0.32
R9498:Cdh22	UTSW	2	165112570	missense	probably damaging	1.00
R9638:Cdh22	UTSW	2	165146767	missense	probably damaging	0.97
R9657:Cdh22	UTSW	2	165123795	missense	probably benign	0.01
Z1088:Cdh22	UTSW	2	165112430	missense	probably benign	0.01
Z1176:Cdh22	UTSW	2	165116184	missense	probably damaging	1.00
Z1177:Cdh22	UTSW	2	165146680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTCGAAAACCCTGAGTGG -3'
(R):5'- CCCACAGAGATGTACCAGTTC -3'

Sequencing Primer
(F):5'- CTCGAAAACCCTGAGTGGTTACG -3'
(R):5'- TGTACCAGTTCAGCATACAGGAGTC -3'

Posted On

2015-04-30