Incidental Mutation 'R4021:Vps13d'
ID 313227
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Name vacuolar protein sorting 13D
Synonyms
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4021 (G1)
Quality Score 219
Status Validated
Chromosome 4
Chromosomal Location 144972622-145195005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145075061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2349 (V2349A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579] [ENSMUST00000130704]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000020441
AA Change: V3498A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: V3498A

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000036579
AA Change: V3529A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: V3529A

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130704
AA Change: V414A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118699
Gene: ENSMUSG00000020220
AA Change: V414A

DomainStartEndE-ValueType
Pfam:DUF1162 162 446 1.4e-111 PFAM
low complexity region 713 726 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155670
Predicted Effect possibly damaging
Transcript: ENSMUST00000185113
AA Change: V2349A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 (GRCm38) L102P probably benign Het
Adcy4 C T 14: 55,775,178 (GRCm38) probably null Het
Adgrf5 A T 17: 43,430,714 (GRCm38) probably benign Het
Atp11a A G 8: 12,842,938 (GRCm38) K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 (GRCm38) T428M probably damaging Het
Cdh22 T C 2: 165,143,673 (GRCm38) D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 (GRCm38) probably null Het
Csnk2a1 C T 2: 152,258,689 (GRCm38) T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 (GRCm38) probably null Het
Ddias G T 7: 92,861,478 (GRCm38) D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 (GRCm38) D238G probably damaging Het
Dock7 T C 4: 99,003,920 (GRCm38) probably null Het
Dock9 T C 14: 121,626,912 (GRCm38) K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 (GRCm38) R50Q probably benign Het
Fam107b G A 2: 3,778,474 (GRCm38) R238Q probably damaging Het
Fam186a G C 15: 99,941,799 (GRCm38) T2188S possibly damaging Het
Farsa A G 8: 84,868,870 (GRCm38) T465A probably damaging Het
Fibp T C 19: 5,460,734 (GRCm38) probably null Het
Flywch2 G A 17: 23,777,039 (GRCm38) T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 (GRCm38) D49V probably damaging Het
Fstl5 A G 3: 76,628,975 (GRCm38) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm38) T158I probably damaging Het
Gbp4 T A 5: 105,120,923 (GRCm38) R455W probably damaging Het
Gm11492 A G 11: 87,567,280 (GRCm38) E160G probably damaging Het
Got2 T G 8: 95,877,753 (GRCm38) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm38) F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 (GRCm38) M186V probably benign Het
Haus2 A T 2: 120,615,930 (GRCm38) Q111L probably damaging Het
Hexd T C 11: 121,218,161 (GRCm38) probably null Het
Igf2r T A 17: 12,748,751 (GRCm38) N27I probably damaging Het
Itgax T A 7: 128,133,139 (GRCm38) probably null Het
Krit1 T A 5: 3,832,132 (GRCm38) I596K probably benign Het
Lair1 A G 7: 4,055,916 (GRCm38) probably null Het
Lilra6 G T 7: 3,911,418 (GRCm38) T276K probably benign Het
Mast4 G A 13: 102,739,321 (GRCm38) R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 (GRCm38) I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 (GRCm38) C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 (GRCm38) R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 (GRCm38) E3406K probably damaging Het
Myo15b A G 11: 115,873,505 (GRCm38) H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 (GRCm38) F681L probably benign Het
Or2ag19 T A 7: 106,845,019 (GRCm38) M136K probably damaging Het
Or5l14 T A 2: 87,962,722 (GRCm38) T57S possibly damaging Het
Pear1 T C 3: 87,756,222 (GRCm38) N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 (GRCm38) A352V probably benign Het
Rnf17 C T 14: 56,460,001 (GRCm38) H451Y probably damaging Het
Sag A T 1: 87,821,305 (GRCm38) probably null Het
Slc22a2 T C 17: 12,584,489 (GRCm38) L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 (GRCm38) probably benign Het
Spag17 A T 3: 100,049,230 (GRCm38) I881F probably benign Het
Taar7a G T 10: 23,993,386 (GRCm38) N32K probably benign Het
Tbck C A 3: 132,727,134 (GRCm38) T435K probably damaging Het
Tril T G 6: 53,819,019 (GRCm38) D406A probably damaging Het
Tshz2 G A 2: 169,885,862 (GRCm38) D324N probably damaging Het
Wdr6 A G 9: 108,575,206 (GRCm38) W493R probably damaging Het
Wdr72 G A 9: 74,151,593 (GRCm38) V323I probably benign Het
Zfp488 T A 14: 33,971,153 (GRCm38) M18L probably benign Het
Zic4 A G 9: 91,379,036 (GRCm38) T108A probably benign Het
Znrf3 T C 11: 5,281,278 (GRCm38) D745G possibly damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145,168,540 (GRCm38) missense probably damaging 0.98
IGL00484:Vps13d APN 4 145,126,575 (GRCm38) missense probably benign 0.04
IGL00591:Vps13d APN 4 145,190,559 (GRCm38) missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145,155,994 (GRCm38) missense probably benign 0.00
IGL00835:Vps13d APN 4 145,160,652 (GRCm38) missense probably damaging 0.97
IGL00847:Vps13d APN 4 145,085,408 (GRCm38) missense probably benign 0.26
IGL01084:Vps13d APN 4 145,154,955 (GRCm38) missense probably benign 0.00
IGL01116:Vps13d APN 4 144,972,750 (GRCm38) unclassified probably benign
IGL01150:Vps13d APN 4 145,149,275 (GRCm38) missense probably benign
IGL01329:Vps13d APN 4 145,156,206 (GRCm38) missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145,088,322 (GRCm38) missense probably damaging 1.00
IGL01583:Vps13d APN 4 145,045,088 (GRCm38) missense probably damaging 1.00
IGL01598:Vps13d APN 4 145,016,901 (GRCm38) missense probably benign 0.21
IGL01620:Vps13d APN 4 145,094,867 (GRCm38) missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145,075,048 (GRCm38) missense probably damaging 1.00
IGL01723:Vps13d APN 4 145,173,145 (GRCm38) missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145,156,266 (GRCm38) missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145,086,747 (GRCm38) missense probably damaging 0.99
IGL02192:Vps13d APN 4 145,148,858 (GRCm38) missense probably benign 0.02
IGL02197:Vps13d APN 4 145,128,309 (GRCm38) missense probably benign 0.01
IGL02209:Vps13d APN 4 145,156,101 (GRCm38) missense probably damaging 0.97
IGL02219:Vps13d APN 4 145,168,146 (GRCm38) missense probably benign 0.00
IGL02377:Vps13d APN 4 145,156,364 (GRCm38) missense probably damaging 1.00
IGL02404:Vps13d APN 4 145,148,735 (GRCm38) missense probably damaging 1.00
IGL02552:Vps13d APN 4 145,173,137 (GRCm38) missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145,164,559 (GRCm38) missense probably benign 0.02
IGL02708:Vps13d APN 4 145,128,280 (GRCm38) missense probably benign 0.12
IGL02811:Vps13d APN 4 145,131,765 (GRCm38) missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145,148,762 (GRCm38) missense probably damaging 0.98
IGL02838:Vps13d APN 4 145,075,025 (GRCm38) missense probably benign 0.31
IGL02968:Vps13d APN 4 145,122,498 (GRCm38) missense probably benign 0.32
IGL03176:Vps13d APN 4 145,074,963 (GRCm38) missense probably benign 0.16
IGL03352:Vps13d APN 4 145,167,502 (GRCm38) missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145,108,575 (GRCm38) missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145,091,947 (GRCm38) missense probably damaging 1.00
IGL03383:Vps13d APN 4 145,168,319 (GRCm38) critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145,149,324 (GRCm38) missense probably damaging 1.00
broken UTSW 4 145,086,735 (GRCm38) missense
demotion UTSW 4 145,138,613 (GRCm38) missense
BB008:Vps13d UTSW 4 145,096,284 (GRCm38) nonsense probably null
BB018:Vps13d UTSW 4 145,096,284 (GRCm38) nonsense probably null
PIT4283001:Vps13d UTSW 4 145,108,588 (GRCm38) missense
PIT4434001:Vps13d UTSW 4 145,155,247 (GRCm38) missense
R0069:Vps13d UTSW 4 145,062,563 (GRCm38) missense probably benign 0.09
R0069:Vps13d UTSW 4 145,062,563 (GRCm38) missense probably benign 0.09
R0076:Vps13d UTSW 4 145,164,694 (GRCm38) splice site probably benign
R0211:Vps13d UTSW 4 145,114,778 (GRCm38) missense probably benign 0.08
R0219:Vps13d UTSW 4 145,105,909 (GRCm38) missense probably benign 0.01
R0284:Vps13d UTSW 4 145,144,802 (GRCm38) missense probably benign 0.01
R0345:Vps13d UTSW 4 145,117,625 (GRCm38) missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145,065,827 (GRCm38) missense probably benign 0.00
R0417:Vps13d UTSW 4 144,976,560 (GRCm38) missense probably benign 0.19
R0538:Vps13d UTSW 4 145,045,095 (GRCm38) missense probably damaging 1.00
R0560:Vps13d UTSW 4 145,054,190 (GRCm38) missense probably damaging 1.00
R0627:Vps13d UTSW 4 145,087,184 (GRCm38) missense probably damaging 1.00
R0707:Vps13d UTSW 4 145,155,932 (GRCm38) missense probably damaging 1.00
R0782:Vps13d UTSW 4 145,126,625 (GRCm38) splice site probably benign
R0925:Vps13d UTSW 4 145,156,551 (GRCm38) missense probably damaging 1.00
R0993:Vps13d UTSW 4 145,117,692 (GRCm38) nonsense probably null
R1135:Vps13d UTSW 4 145,155,589 (GRCm38) missense probably benign 0.01
R1165:Vps13d UTSW 4 145,126,471 (GRCm38) missense probably benign
R1263:Vps13d UTSW 4 145,170,348 (GRCm38) missense probably benign 0.01
R1397:Vps13d UTSW 4 145,141,334 (GRCm38) missense probably damaging 1.00
R1398:Vps13d UTSW 4 145,099,983 (GRCm38) missense probably null
R1521:Vps13d UTSW 4 145,105,861 (GRCm38) missense probably benign 0.00
R1522:Vps13d UTSW 4 145,098,172 (GRCm38) splice site probably null
R1725:Vps13d UTSW 4 145,143,260 (GRCm38) missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145,155,857 (GRCm38) missense probably benign
R1826:Vps13d UTSW 4 145,155,003 (GRCm38) missense probably damaging 0.96
R1900:Vps13d UTSW 4 145,126,606 (GRCm38) missense probably benign 0.23
R1943:Vps13d UTSW 4 145,155,857 (GRCm38) missense probably benign
R1955:Vps13d UTSW 4 145,156,143 (GRCm38) missense probably damaging 1.00
R2008:Vps13d UTSW 4 145,155,243 (GRCm38) missense probably benign 0.00
R2013:Vps13d UTSW 4 145,108,508 (GRCm38) missense probably damaging 0.99
R2014:Vps13d UTSW 4 145,108,508 (GRCm38) missense probably damaging 0.99
R2038:Vps13d UTSW 4 145,181,115 (GRCm38) critical splice donor site probably null
R2108:Vps13d UTSW 4 145,075,047 (GRCm38) missense probably damaging 0.99
R2130:Vps13d UTSW 4 145,156,101 (GRCm38) missense probably benign 0.17
R2134:Vps13d UTSW 4 145,148,339 (GRCm38) missense probably benign 0.00
R2168:Vps13d UTSW 4 145,087,323 (GRCm38) splice site probably benign
R2220:Vps13d UTSW 4 145,178,320 (GRCm38) missense probably damaging 1.00
R2240:Vps13d UTSW 4 145,110,895 (GRCm38) missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145,148,686 (GRCm38) missense probably benign
R2357:Vps13d UTSW 4 145,074,977 (GRCm38) frame shift probably null
R2365:Vps13d UTSW 4 145,087,324 (GRCm38) splice site probably benign
R2571:Vps13d UTSW 4 145,149,136 (GRCm38) missense probably benign 0.20
R3149:Vps13d UTSW 4 145,126,577 (GRCm38) missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145,086,790 (GRCm38) missense probably damaging 0.98
R3547:Vps13d UTSW 4 145,074,975 (GRCm38) missense probably damaging 0.99
R3716:Vps13d UTSW 4 145,075,726 (GRCm38) missense probably damaging 1.00
R3718:Vps13d UTSW 4 145,075,726 (GRCm38) missense probably damaging 1.00
R3725:Vps13d UTSW 4 145,115,648 (GRCm38) splice site probably benign
R3794:Vps13d UTSW 4 145,085,437 (GRCm38) splice site probably benign
R3875:Vps13d UTSW 4 145,190,544 (GRCm38) missense probably damaging 1.00
R3948:Vps13d UTSW 4 145,141,340 (GRCm38) missense probably damaging 1.00
R3953:Vps13d UTSW 4 145,148,880 (GRCm38) missense probably damaging 1.00
R4323:Vps13d UTSW 4 145,152,778 (GRCm38) missense probably benign 0.28
R4346:Vps13d UTSW 4 145,072,529 (GRCm38) intron probably benign
R4509:Vps13d UTSW 4 145,062,602 (GRCm38) missense probably damaging 1.00
R4613:Vps13d UTSW 4 145,131,655 (GRCm38) missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145,074,842 (GRCm38) missense probably damaging 1.00
R4680:Vps13d UTSW 4 145,108,510 (GRCm38) missense possibly damaging 0.94
R4688:Vps13d UTSW 4 145,178,212 (GRCm38) missense probably benign
R4797:Vps13d UTSW 4 145,054,155 (GRCm38) missense probably damaging 1.00
R4798:Vps13d UTSW 4 145,178,056 (GRCm38) missense probably damaging 0.98
R4817:Vps13d UTSW 4 145,069,165 (GRCm38) missense probably damaging 1.00
R4839:Vps13d UTSW 4 145,085,430 (GRCm38) missense possibly damaging 0.95
R4860:Vps13d UTSW 4 145,087,161 (GRCm38) missense probably benign
R4860:Vps13d UTSW 4 145,087,161 (GRCm38) missense probably benign
R4869:Vps13d UTSW 4 145,128,042 (GRCm38) missense probably damaging 1.00
R4904:Vps13d UTSW 4 145,155,445 (GRCm38) missense probably damaging 1.00
R4912:Vps13d UTSW 4 145,155,857 (GRCm38) missense probably benign
R4916:Vps13d UTSW 4 144,983,393 (GRCm38) missense probably damaging 1.00
R4976:Vps13d UTSW 4 145,105,898 (GRCm38) missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145,156,282 (GRCm38) missense probably benign 0.02
R5049:Vps13d UTSW 4 145,086,766 (GRCm38) missense probably damaging 1.00
R5077:Vps13d UTSW 4 145,088,241 (GRCm38) missense probably damaging 0.98
R5119:Vps13d UTSW 4 145,105,898 (GRCm38) missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145,181,207 (GRCm38) splice site probably null
R5291:Vps13d UTSW 4 145,062,569 (GRCm38) missense probably damaging 0.99
R5344:Vps13d UTSW 4 145,178,334 (GRCm38) missense probably damaging 0.98
R5348:Vps13d UTSW 4 145,065,889 (GRCm38) missense probably damaging 0.99
R5478:Vps13d UTSW 4 145,167,550 (GRCm38) missense probably damaging 0.99
R5632:Vps13d UTSW 4 145,074,882 (GRCm38) missense probably damaging 0.99
R5642:Vps13d UTSW 4 145,170,302 (GRCm38) missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145,087,173 (GRCm38) missense probably benign 0.07
R5747:Vps13d UTSW 4 145,168,283 (GRCm38) missense probably benign 0.00
R5752:Vps13d UTSW 4 145,148,970 (GRCm38) missense probably benign 0.06
R5804:Vps13d UTSW 4 145,100,070 (GRCm38) missense probably benign 0.03
R5917:Vps13d UTSW 4 145,100,010 (GRCm38) missense probably damaging 0.96
R5932:Vps13d UTSW 4 145,045,041 (GRCm38) missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145,074,975 (GRCm38) missense probably benign 0.09
R5978:Vps13d UTSW 4 145,122,611 (GRCm38) missense probably benign
R6031:Vps13d UTSW 4 145,168,509 (GRCm38) missense probably benign 0.01
R6031:Vps13d UTSW 4 145,168,509 (GRCm38) missense probably benign 0.01
R6143:Vps13d UTSW 4 145,148,565 (GRCm38) missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144,975,193 (GRCm38) nonsense probably null
R6191:Vps13d UTSW 4 145,149,348 (GRCm38) missense probably damaging 1.00
R6198:Vps13d UTSW 4 145,148,990 (GRCm38) missense probably benign 0.28
R6374:Vps13d UTSW 4 145,122,681 (GRCm38) missense probably damaging 1.00
R6379:Vps13d UTSW 4 145,088,258 (GRCm38) missense probably benign
R6388:Vps13d UTSW 4 145,155,574 (GRCm38) missense probably benign 0.06
R6418:Vps13d UTSW 4 145,092,280 (GRCm38) missense probably damaging 0.98
R6466:Vps13d UTSW 4 145,057,495 (GRCm38) missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145,103,664 (GRCm38) intron probably benign
R6604:Vps13d UTSW 4 145,181,124 (GRCm38) missense probably damaging 1.00
R7051:Vps13d UTSW 4 145,163,344 (GRCm38) missense probably benign 0.00
R7052:Vps13d UTSW 4 145,163,344 (GRCm38) missense probably benign 0.00
R7103:Vps13d UTSW 4 145,115,492 (GRCm38) missense
R7231:Vps13d UTSW 4 145,057,462 (GRCm38) missense
R7246:Vps13d UTSW 4 145,156,050 (GRCm38) missense
R7339:Vps13d UTSW 4 145,121,368 (GRCm38) missense
R7409:Vps13d UTSW 4 145,141,254 (GRCm38) missense
R7419:Vps13d UTSW 4 145,115,503 (GRCm38) missense
R7424:Vps13d UTSW 4 145,148,747 (GRCm38) missense
R7439:Vps13d UTSW 4 145,105,856 (GRCm38) missense
R7440:Vps13d UTSW 4 145,128,411 (GRCm38) missense
R7528:Vps13d UTSW 4 145,091,922 (GRCm38) missense
R7547:Vps13d UTSW 4 145,057,538 (GRCm38) missense
R7558:Vps13d UTSW 4 145,154,580 (GRCm38) missense
R7699:Vps13d UTSW 4 145,085,405 (GRCm38) missense
R7729:Vps13d UTSW 4 145,075,052 (GRCm38) missense
R7789:Vps13d UTSW 4 145,100,065 (GRCm38) missense
R7813:Vps13d UTSW 4 145,178,063 (GRCm38) nonsense probably null
R7834:Vps13d UTSW 4 145,108,573 (GRCm38) missense
R7840:Vps13d UTSW 4 145,103,676 (GRCm38) missense
R7880:Vps13d UTSW 4 145,181,114 (GRCm38) critical splice donor site probably null
R7912:Vps13d UTSW 4 145,173,127 (GRCm38) missense
R7915:Vps13d UTSW 4 145,086,819 (GRCm38) missense
R7931:Vps13d UTSW 4 145,096,284 (GRCm38) nonsense probably null
R8021:Vps13d UTSW 4 145,148,675 (GRCm38) missense
R8048:Vps13d UTSW 4 145,155,567 (GRCm38) missense
R8057:Vps13d UTSW 4 144,975,183 (GRCm38) missense
R8063:Vps13d UTSW 4 145,114,757 (GRCm38) missense
R8131:Vps13d UTSW 4 145,156,137 (GRCm38) missense
R8190:Vps13d UTSW 4 145,152,751 (GRCm38) missense
R8226:Vps13d UTSW 4 145,149,290 (GRCm38) missense
R8241:Vps13d UTSW 4 145,148,477 (GRCm38) missense
R8254:Vps13d UTSW 4 144,983,312 (GRCm38) splice site probably benign
R8305:Vps13d UTSW 4 145,092,288 (GRCm38) missense
R8415:Vps13d UTSW 4 145,091,979 (GRCm38) missense
R8460:Vps13d UTSW 4 145,170,439 (GRCm38) intron probably benign
R8487:Vps13d UTSW 4 145,155,247 (GRCm38) missense probably benign 0.11
R8543:Vps13d UTSW 4 145,016,783 (GRCm38) nonsense probably null
R8679:Vps13d UTSW 4 145,085,407 (GRCm38) missense
R8716:Vps13d UTSW 4 145,075,778 (GRCm38) missense
R8749:Vps13d UTSW 4 145,138,613 (GRCm38) missense
R8772:Vps13d UTSW 4 145,075,032 (GRCm38) missense
R8788:Vps13d UTSW 4 145,086,735 (GRCm38) missense
R8789:Vps13d UTSW 4 145,069,173 (GRCm38) missense
R8836:Vps13d UTSW 4 145,156,078 (GRCm38) missense
R8874:Vps13d UTSW 4 145,155,202 (GRCm38) missense
R8918:Vps13d UTSW 4 145,046,303 (GRCm38) missense
R9129:Vps13d UTSW 4 145,171,679 (GRCm38) missense
R9220:Vps13d UTSW 4 145,056,488 (GRCm38) missense
R9233:Vps13d UTSW 4 145,152,774 (GRCm38) missense
R9234:Vps13d UTSW 4 145,149,222 (GRCm38) missense
R9256:Vps13d UTSW 4 145,155,804 (GRCm38) missense
R9350:Vps13d UTSW 4 145,155,763 (GRCm38) missense
R9398:Vps13d UTSW 4 145,170,386 (GRCm38) nonsense probably null
R9415:Vps13d UTSW 4 145,069,957 (GRCm38) missense
R9438:Vps13d UTSW 4 145,131,744 (GRCm38) missense
R9469:Vps13d UTSW 4 145,054,121 (GRCm38) missense
R9487:Vps13d UTSW 4 145,081,299 (GRCm38) critical splice donor site probably null
R9524:Vps13d UTSW 4 145,096,244 (GRCm38) missense
R9616:Vps13d UTSW 4 145,098,131 (GRCm38) missense
R9655:Vps13d UTSW 4 145,086,735 (GRCm38) missense
R9709:Vps13d UTSW 4 145,149,345 (GRCm38) missense
R9767:Vps13d UTSW 4 145,152,736 (GRCm38) missense
R9773:Vps13d UTSW 4 145,092,049 (GRCm38) missense
R9779:Vps13d UTSW 4 145,072,402 (GRCm38) missense
R9796:Vps13d UTSW 4 145,127,935 (GRCm38) critical splice donor site probably null
X0021:Vps13d UTSW 4 145,155,025 (GRCm38) missense probably damaging 0.99
Z1176:Vps13d UTSW 4 145,107,067 (GRCm38) missense
Z1177:Vps13d UTSW 4 145,178,296 (GRCm38) missense
Z1177:Vps13d UTSW 4 145,154,908 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- TTACCCGGAGAACGTGTAGGTG -3'
(R):5'- TGCCCAGTAACAGTTGAGTG -3'

Sequencing Primer
(F):5'- CATAGTACAACTGTCGGTTATTCTGG -3'
(R):5'- GCCCAGTAACAGTTGAGTGTACTAC -3'
Posted On 2015-04-30