Incidental Mutation 'R4021:Chmp3'
ID 313232
Institutional Source Beutler Lab
Gene Symbol Chmp3
Ensembl Gene ENSMUSG00000053119
Gene Name charged multivesicular body protein 3
Synonyms 25.1, CGI-49, 4921505F14Rik, 9130011K15Rik, Vps24, D6Ertd286e
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 71543797-71582609 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 71574238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059462] [ENSMUST00000065364] [ENSMUST00000204199] [ENSMUST00000204535]
AlphaFold Q9CQ10
Predicted Effect probably null
Transcript: ENSMUST00000059462
SMART Domains Protein: ENSMUSP00000109815
Gene: ENSMUSG00000053119

DomainStartEndE-ValueType
Pfam:Snf7 18 188 7.6e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065364
SMART Domains Protein: ENSMUSP00000068410
Gene: ENSMUSG00000053119

DomainStartEndE-ValueType
Pfam:Snf7 18 190 4.7e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142169
Predicted Effect probably null
Transcript: ENSMUST00000204199
SMART Domains Protein: ENSMUSP00000144867
Gene: ENSMUSG00000053119

DomainStartEndE-ValueType
Pfam:Snf7 35 96 1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204535
SMART Domains Protein: ENSMUSP00000145223
Gene: ENSMUSG00000053119

DomainStartEndE-ValueType
Pfam:Snf7 1 60 1.3e-11 PFAM
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that sorts transmembrane proteins into lysosomes/vacuoles via the multivesicular body (MVB) pathway. This protein, along with other soluble coiled-coil containing proteins, forms part of the ESCRT-III protein complex that binds to the endosomal membrane and recruits additional cofactors for protein sorting into the MVB. This protein may also co-immunoprecipitate with a member of the IFG-binding protein superfamily. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ring finger protein 103 (RNF103) gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 (GRCm38) L102P probably benign Het
Adcy4 C T 14: 55,775,178 (GRCm38) probably null Het
Adgrf5 A T 17: 43,430,714 (GRCm38) probably benign Het
Atp11a A G 8: 12,842,938 (GRCm38) K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 (GRCm38) T428M probably damaging Het
Cdh22 T C 2: 165,143,673 (GRCm38) D331G possibly damaging Het
Csnk2a1 C T 2: 152,258,689 (GRCm38) T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 (GRCm38) probably null Het
Ddias G T 7: 92,861,478 (GRCm38) D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 (GRCm38) D238G probably damaging Het
Dock7 T C 4: 99,003,920 (GRCm38) probably null Het
Dock9 T C 14: 121,626,912 (GRCm38) K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 (GRCm38) R50Q probably benign Het
Fam107b G A 2: 3,778,474 (GRCm38) R238Q probably damaging Het
Fam186a G C 15: 99,941,799 (GRCm38) T2188S possibly damaging Het
Farsa A G 8: 84,868,870 (GRCm38) T465A probably damaging Het
Fibp T C 19: 5,460,734 (GRCm38) probably null Het
Flywch2 G A 17: 23,777,039 (GRCm38) T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 (GRCm38) D49V probably damaging Het
Fstl5 A G 3: 76,628,975 (GRCm38) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm38) T158I probably damaging Het
Gbp4 T A 5: 105,120,923 (GRCm38) R455W probably damaging Het
Gm11492 A G 11: 87,567,280 (GRCm38) E160G probably damaging Het
Got2 T G 8: 95,877,753 (GRCm38) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm38) F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 (GRCm38) M186V probably benign Het
Haus2 A T 2: 120,615,930 (GRCm38) Q111L probably damaging Het
Hexdc T C 11: 121,218,161 (GRCm38) probably null Het
Igf2r T A 17: 12,748,751 (GRCm38) N27I probably damaging Het
Itgax T A 7: 128,133,139 (GRCm38) probably null Het
Krit1 T A 5: 3,832,132 (GRCm38) I596K probably benign Het
Lair1 A G 7: 4,055,916 (GRCm38) probably null Het
Lilra6 G T 7: 3,911,418 (GRCm38) T276K probably benign Het
Mast4 G A 13: 102,739,321 (GRCm38) R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 (GRCm38) I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 (GRCm38) C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 (GRCm38) R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 (GRCm38) E3406K probably damaging Het
Myo15b A G 11: 115,873,505 (GRCm38) H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 (GRCm38) F681L probably benign Het
Olfr1157 T A 2: 87,962,722 (GRCm38) T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 (GRCm38) M136K probably damaging Het
Pear1 T C 3: 87,756,222 (GRCm38) N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 (GRCm38) A352V probably benign Het
Rnf17 C T 14: 56,460,001 (GRCm38) H451Y probably damaging Het
Sag A T 1: 87,821,305 (GRCm38) probably null Het
Slc22a2 T C 17: 12,584,489 (GRCm38) L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 (GRCm38) probably benign Het
Spag17 A T 3: 100,049,230 (GRCm38) I881F probably benign Het
Taar7a G T 10: 23,993,386 (GRCm38) N32K probably benign Het
Tbck C A 3: 132,727,134 (GRCm38) T435K probably damaging Het
Tril T G 6: 53,819,019 (GRCm38) D406A probably damaging Het
Tshz2 G A 2: 169,885,862 (GRCm38) D324N probably damaging Het
Vps13d A G 4: 145,075,061 (GRCm38) V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 (GRCm38) W493R probably damaging Het
Wdr72 G A 9: 74,151,593 (GRCm38) V323I probably benign Het
Zfp488 T A 14: 33,971,153 (GRCm38) M18L probably benign Het
Zic4 A G 9: 91,379,036 (GRCm38) T108A probably benign Het
Znrf3 T C 11: 5,281,278 (GRCm38) D745G possibly damaging Het
Other mutations in Chmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02649:Chmp3 APN 6 71,552,433 (GRCm38) missense possibly damaging 0.68
R0497:Chmp3 UTSW 6 71,552,411 (GRCm38) missense probably damaging 0.97
R1558:Chmp3 UTSW 6 71,560,970 (GRCm38) nonsense probably null
R1778:Chmp3 UTSW 6 71,577,807 (GRCm38) missense probably benign 0.04
R1829:Chmp3 UTSW 6 71,560,939 (GRCm38) missense probably benign 0.01
R3619:Chmp3 UTSW 6 71,577,825 (GRCm38) missense probably damaging 1.00
R7469:Chmp3 UTSW 6 71,579,668 (GRCm38) missense possibly damaging 0.61
R7819:Chmp3 UTSW 6 71,561,024 (GRCm38) nonsense probably null
R8112:Chmp3 UTSW 6 71,561,028 (GRCm38) missense probably benign 0.00
Z1176:Chmp3 UTSW 6 71,579,775 (GRCm38) missense probably damaging 1.00
Z1176:Chmp3 UTSW 6 71,560,964 (GRCm38) missense probably benign
Z1177:Chmp3 UTSW 6 71,543,804 (GRCm38) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGGAGCTCTCTCATTCTGTG -3'
(R):5'- CATTGCGAGATGTTCCCTGTC -3'

Sequencing Primer
(F):5'- GGAGCTCTCTCATTCTGTGCTGTC -3'
(R):5'- CCTGTCTGGAGATCTAGGCATTC -3'
Posted On 2015-04-30