Mutagenetix > Incidental Mutation

Incidental Mutation 'R4021:Lair1'

313234

Institutional Source

Beutler Lab

Gene Symbol

Lair1

Ensembl Gene

ENSMUSG00000055541

Gene Name

leukocyte-associated Ig-like receptor 1

Synonyms

mLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e

MMRRC Submission

040955-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4003402-4063204 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 4055916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]

AlphaFold

Q8BG84

Predicted Effect

probably null
Transcript: ENSMUST00000068865

SMART Domains

Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	33	55	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000086400

SMART Domains

Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	5e-79	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	9e-27	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000086401

SMART Domains

Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	1e-78	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	2e-26	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108600

SMART Domains

Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	133	8e-79	PDB
SCOP:d1nkr_2	24	118	1e-9	SMART
Blast:IG	38	119	6e-27	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119711

SMART Domains

Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	133	4e-79	PDB
SCOP:d1nkr_2	24	118	7e-9	SMART
Blast:IG	38	119	2e-27	BLAST

Predicted Effect

silent
Transcript: ENSMUST00000131126

SMART Domains

Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000136616

SMART Domains

Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000149395

SMART Domains

Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000205296

Meta Mutation Damage Score

0.9481

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cacna2d2	C	T	9: 107,514,058	T428M	probably damaging	Het
Cdh22	T	C	2: 165,143,673	D331G	possibly damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Itgax	T	A	7: 128,133,139		probably null	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mroh2b	T	A	15: 4,925,100	C682S	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Lair1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lair1	APN	7	4028731	missense	probably benign	0.01
IGL01475:Lair1	APN	7	4009684	utr 3 prime	probably benign
IGL02696:Lair1	APN	7	4010849	intron	probably benign
IGL02749:Lair1	APN	7	4028901	missense	possibly damaging	0.50
R0396:Lair1	UTSW	7	4010786	missense	probably damaging	1.00
R0703:Lair1	UTSW	7	4010760	missense	probably null	0.99
R1053:Lair1	UTSW	7	4028785	missense	probably damaging	1.00
R1332:Lair1	UTSW	7	4010596	missense	possibly damaging	0.77
R1717:Lair1	UTSW	7	4010789	missense	probably damaging	1.00
R2022:Lair1	UTSW	7	4063064	splice site	probably null
R2509:Lair1	UTSW	7	4010783	missense	probably damaging	1.00
R3721:Lair1	UTSW	7	4010783	missense	probably damaging	1.00
R4784:Lair1	UTSW	7	4009732	missense	probably benign	0.15
R4873:Lair1	UTSW	7	4029034	missense	probably benign	0.05
R4875:Lair1	UTSW	7	4029034	missense	probably benign	0.05
R4940:Lair1	UTSW	7	4028949	missense	probably benign	0.00
R5125:Lair1	UTSW	7	4010489	missense	possibly damaging	0.92
R5178:Lair1	UTSW	7	4010489	missense	possibly damaging	0.92
R5888:Lair1	UTSW	7	4010845	missense	probably damaging	0.96
R5965:Lair1	UTSW	7	4029024	missense	possibly damaging	0.46
R6119:Lair1	UTSW	7	4028896	missense	probably benign	0.43
R6265:Lair1	UTSW	7	4055827	intron	probably benign
R6305:Lair1	UTSW	7	4010728	critical splice donor site	probably null
R6915:Lair1	UTSW	7	4055953	missense	possibly damaging	0.89
R7964:Lair1	UTSW	7	4010804	missense	probably benign	0.22
R7991:Lair1	UTSW	7	4028970	missense	probably damaging	1.00
R9414:Lair1	UTSW	7	4010820	missense	probably benign	0.09
R9787:Lair1	UTSW	7	4010795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAAAGTGCACATCAAAACAGCATG -3'
(R):5'- CTCTGACATTAATGTGGAGGAGC -3'

Sequencing Primer
(F):5'- CATCAAAACAGCATGCTTCATTTC -3'
(R):5'- CAGAGGAGAAATGGCTGTGTAATC -3'

Posted On

2015-04-30