Incidental Mutation 'R4021:Lair1'
ID 313234
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Name leukocyte-associated Ig-like receptor 1
Synonyms 5133400O11Rik, Lair-1, D7Bwg0421e, mLair-1
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 4006401-4066203 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4058915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000149395] [ENSMUST00000205296] [ENSMUST00000136616]
AlphaFold Q8BG84
Predicted Effect probably null
Transcript: ENSMUST00000068865
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086400
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086401
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108600
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119711
SMART Domains Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 4e-79 PDB
SCOP:d1nkr_2 24 118 7e-9 SMART
Blast:IG 38 119 2e-27 BLAST
Predicted Effect silent
Transcript: ENSMUST00000131126
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000149395
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205296
Predicted Effect silent
Transcript: ENSMUST00000136616
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam107b G A 2: 3,779,511 (GRCm39) R238Q probably damaging Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Farsa A G 8: 85,595,499 (GRCm39) T465A probably damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Got2 T G 8: 96,604,381 (GRCm39) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Hexd T C 11: 121,108,987 (GRCm39) probably null Het
Igf2r T A 17: 12,967,638 (GRCm39) N27I probably damaging Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mroh2b T A 15: 4,954,582 (GRCm39) C682S possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4,031,730 (GRCm39) missense probably benign 0.01
IGL01475:Lair1 APN 7 4,012,683 (GRCm39) utr 3 prime probably benign
IGL02696:Lair1 APN 7 4,013,848 (GRCm39) intron probably benign
IGL02749:Lair1 APN 7 4,031,900 (GRCm39) missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4,013,785 (GRCm39) missense probably damaging 1.00
R0703:Lair1 UTSW 7 4,013,759 (GRCm39) missense probably null 0.99
R1053:Lair1 UTSW 7 4,031,784 (GRCm39) missense probably damaging 1.00
R1332:Lair1 UTSW 7 4,013,595 (GRCm39) missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4,013,788 (GRCm39) missense probably damaging 1.00
R2022:Lair1 UTSW 7 4,066,063 (GRCm39) splice site probably null
R2509:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R3721:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R4784:Lair1 UTSW 7 4,012,731 (GRCm39) missense probably benign 0.15
R4873:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4875:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4940:Lair1 UTSW 7 4,031,948 (GRCm39) missense probably benign 0.00
R5125:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4,013,844 (GRCm39) missense probably damaging 0.96
R5965:Lair1 UTSW 7 4,032,023 (GRCm39) missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4,031,895 (GRCm39) missense probably benign 0.43
R6265:Lair1 UTSW 7 4,058,826 (GRCm39) intron probably benign
R6305:Lair1 UTSW 7 4,013,727 (GRCm39) critical splice donor site probably null
R6915:Lair1 UTSW 7 4,058,952 (GRCm39) missense possibly damaging 0.89
R7964:Lair1 UTSW 7 4,013,803 (GRCm39) missense probably benign 0.22
R7991:Lair1 UTSW 7 4,031,969 (GRCm39) missense probably damaging 1.00
R9414:Lair1 UTSW 7 4,013,819 (GRCm39) missense probably benign 0.09
R9787:Lair1 UTSW 7 4,013,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGTGCACATCAAAACAGCATG -3'
(R):5'- CTCTGACATTAATGTGGAGGAGC -3'

Sequencing Primer
(F):5'- CATCAAAACAGCATGCTTCATTTC -3'
(R):5'- CAGAGGAGAAATGGCTGTGTAATC -3'
Posted On 2015-04-30