Incidental Mutation 'R4021:Lair1'
ID313234
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Nameleukocyte-associated Ig-like receptor 1
SynonymsmLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4003402-4063204 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4055916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]
Predicted Effect probably null
Transcript: ENSMUST00000068865
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086400
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086401
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108600
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119711
SMART Domains Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 4e-79 PDB
SCOP:d1nkr_2 24 118 7e-9 SMART
Blast:IG 38 119 2e-27 BLAST
Predicted Effect silent
Transcript: ENSMUST00000131126
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000136616
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000149395
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205296
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4028731 missense probably benign 0.01
IGL01475:Lair1 APN 7 4009684 utr 3 prime probably benign
IGL02696:Lair1 APN 7 4010849 intron probably benign
IGL02749:Lair1 APN 7 4028901 missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4010786 missense probably damaging 1.00
R0703:Lair1 UTSW 7 4010760 missense probably null 0.99
R1053:Lair1 UTSW 7 4028785 missense probably damaging 1.00
R1332:Lair1 UTSW 7 4010596 missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4010789 missense probably damaging 1.00
R2022:Lair1 UTSW 7 4063064 splice site probably null
R2509:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R3721:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R4784:Lair1 UTSW 7 4009732 missense probably benign 0.15
R4873:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4875:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4940:Lair1 UTSW 7 4028949 missense probably benign 0.00
R5125:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4010845 missense probably damaging 0.96
R5965:Lair1 UTSW 7 4029024 missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4028896 missense probably benign 0.43
R6265:Lair1 UTSW 7 4055827 intron probably benign
R6305:Lair1 UTSW 7 4010728 critical splice donor site probably null
R6915:Lair1 UTSW 7 4055953 missense possibly damaging 0.89
R7964:Lair1 UTSW 7 4010804 missense probably benign 0.22
R7991:Lair1 UTSW 7 4028970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGTGCACATCAAAACAGCATG -3'
(R):5'- CTCTGACATTAATGTGGAGGAGC -3'

Sequencing Primer
(F):5'- CATCAAAACAGCATGCTTCATTTC -3'
(R):5'- CAGAGGAGAAATGGCTGTGTAATC -3'
Posted On2015-04-30