Incidental Mutation 'R4021:Ddias'
ID313237
Institutional Source Beutler Lab
Gene Symbol Ddias
Ensembl Gene ENSMUSG00000030641
Gene NameDNA damage-induced apoptosis suppressor
Synonymsnoxin, 4632434I11Rik
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92857525-92874247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92861478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 105 (D105E)
Ref Sequence ENSEMBL: ENSMUSP00000146512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032877] [ENSMUST00000208356] [ENSMUST00000209074]
Predicted Effect probably benign
Transcript: ENSMUST00000032877
AA Change: D105E

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032877
Gene: ENSMUSG00000030641
AA Change: D105E

DomainStartEndE-ValueType
Pfam:Rep_fac-A_C 7 118 2.1e-14 PFAM
low complexity region 197 209 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 727 743 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208356
AA Change: D105E

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000209074
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Ddias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Ddias APN 7 92866622 missense probably damaging 0.98
IGL02820:Ddias APN 7 92859343 missense probably benign 0.07
I0000:Ddias UTSW 7 92866640 missense possibly damaging 0.69
R0094:Ddias UTSW 7 92859900 missense possibly damaging 0.61
R0482:Ddias UTSW 7 92859528 missense probably benign 0.41
R0883:Ddias UTSW 7 92859337 missense probably benign
R1131:Ddias UTSW 7 92859886 missense possibly damaging 0.92
R1722:Ddias UTSW 7 92860042 missense possibly damaging 0.63
R1758:Ddias UTSW 7 92859363 missense probably benign 0.03
R1937:Ddias UTSW 7 92858622 missense probably benign 0.07
R2067:Ddias UTSW 7 92859699 missense possibly damaging 0.79
R2124:Ddias UTSW 7 92858256 missense probably benign 0.00
R2483:Ddias UTSW 7 92859592 missense probably benign 0.13
R3623:Ddias UTSW 7 92859592 missense probably benign 0.13
R3690:Ddias UTSW 7 92860158 missense probably benign 0.24
R4015:Ddias UTSW 7 92859861 missense probably benign 0.06
R4022:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4384:Ddias UTSW 7 92858223 missense probably damaging 0.98
R4410:Ddias UTSW 7 92858079 missense probably benign 0.04
R4691:Ddias UTSW 7 92858816 missense probably damaging 0.99
R5653:Ddias UTSW 7 92858729 missense probably damaging 1.00
R6666:Ddias UTSW 7 92858081 missense probably benign
R6853:Ddias UTSW 7 92859565 missense possibly damaging 0.46
X0027:Ddias UTSW 7 92858995 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTGCTTCTATAGGCTTTACTCTC -3'
(R):5'- TCACATTTGATGCACTGGGTTTAG -3'

Sequencing Primer
(F):5'- GCTTCAATTACCGTTACTCC -3'
(R):5'- CCTTTGTGCTGCAGGAACCTG -3'
Posted On2015-04-30