Incidental Mutation 'R4021:Olfr703'
ID313238
Institutional Source Beutler Lab
Gene Symbol Olfr703
Ensembl Gene ENSMUSG00000073901
Gene Nameolfactory receptor 703
SynonymsMOR283-7, GA_x6K02T2PBJ9-9222217-9223176
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106843360-106846207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106845019 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 136 (M136K)
Ref Sequence ENSEMBL: ENSMUSP00000149022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098142] [ENSMUST00000216254]
Predicted Effect probably damaging
Transcript: ENSMUST00000098142
AA Change: M136K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095746
Gene: ENSMUSG00000073901
AA Change: M136K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.4e-8 PFAM
Pfam:7tm_1 41 290 1.7e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216254
AA Change: M136K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2834 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Olfr703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr703 APN 7 106845367 missense possibly damaging 0.78
IGL01321:Olfr703 APN 7 106844749 missense probably damaging 1.00
IGL02169:Olfr703 APN 7 106845266 nonsense probably null
IGL03376:Olfr703 APN 7 106845470 missense probably damaging 1.00
R0045:Olfr703 UTSW 7 106845389 nonsense probably null
R0662:Olfr703 UTSW 7 106844649 missense probably benign 0.01
R1589:Olfr703 UTSW 7 106845196 missense possibly damaging 0.57
R1869:Olfr703 UTSW 7 106845094 missense probably benign 0.01
R2431:Olfr703 UTSW 7 106845391 missense possibly damaging 0.95
R5280:Olfr703 UTSW 7 106844695 missense probably benign 0.01
R6352:Olfr703 UTSW 7 106845222 missense probably damaging 1.00
R6932:Olfr703 UTSW 7 106844802 nonsense probably null
R7037:Olfr703 UTSW 7 106845336 missense probably damaging 1.00
R7909:Olfr703 UTSW 7 106844992 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTCCTACTTGGACAGCTGTC -3'
(R):5'- TGGATGTATCTTCACAGGCCAG -3'

Sequencing Primer
(F):5'- TGGACAGCTGTCTCTCATGGAC -3'
(R):5'- CAGCTTCAGCAATGGAGGAATCTC -3'
Posted On2015-04-30