Incidental Mutation 'R4021:Itgax'
ID313239
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 128133139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000098015] [ENSMUST00000205460]
Predicted Effect probably null
Transcript: ENSMUST00000033053
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098015
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Predicted Effect probably null
Transcript: ENSMUST00000205460
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
R7599:Itgax UTSW 7 128148090 missense probably damaging 0.99
R7710:Itgax UTSW 7 128135856 missense probably benign 0.04
R7964:Itgax UTSW 7 128140418 critical splice acceptor site probably null
R8220:Itgax UTSW 7 128130918 missense probably benign 0.00
R8730:Itgax UTSW 7 128139894 critical splice acceptor site probably null
R8742:Itgax UTSW 7 128144623 missense probably benign 0.28
R8812:Itgax UTSW 7 128133807 missense probably damaging 1.00
R8871:Itgax UTSW 7 128136051 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Z1176:Itgax UTSW 7 128144872 missense probably benign 0.24
Z1177:Itgax UTSW 7 128148062 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCAGGAGATCTTGTGAGTG -3'
(R):5'- ACAGACTTAAAGGGCTTGACG -3'

Sequencing Primer
(F):5'- TGTCCCTTGGAGAATCAGGAC -3'
(R):5'- CTTAAAGGGCTTGACGTGGAG -3'
Posted On2015-04-30