Mutagenetix > Incidental Mutation

Incidental Mutation 'R4021:Itgax'

313239

Institutional Source

Beutler Lab

Gene Symbol

Itgax

Ensembl Gene

ENSMUSG00000030789

Gene Name

integrin alpha X

Synonyms

Cd11c, CD11C (p150) alpha polypeptide

MMRRC Submission

040955-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128129547-128150657 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 128133139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000098015] [ENSMUST00000205460]

AlphaFold

Q9QXH4

Predicted Effect

probably null
Transcript: ENSMUST00000033053

SMART Domains

Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Int_alpha	33	83	1.28e1	SMART
VWA	150	331	8.36e-43	SMART
Int_alpha	402	451	3.67e-3	SMART
Int_alpha	455	512	1.29e-7	SMART
Int_alpha	518	574	5.72e-14	SMART
Int_alpha	581	635	1.55e-1	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	6.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098015

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205408

Predicted Effect

probably null
Transcript: ENSMUST00000205460

Meta Mutation Damage Score

0.9482

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cacna2d2	C	T	9: 107,514,058	T428M	probably damaging	Het
Cdh22	T	C	2: 165,143,673	D331G	possibly damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lair1	A	G	7: 4,055,916		probably null	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mroh2b	T	A	15: 4,925,100	C682S	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Itgax

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Itgax	APN	7	128135326	missense	probably damaging	1.00
IGL00325:Itgax	APN	7	128148309	missense	possibly damaging	0.69
IGL01155:Itgax	APN	7	128145035	missense	probably benign	0.00
IGL01461:Itgax	APN	7	128135018	missense	probably damaging	1.00
IGL01508:Itgax	APN	7	128144818	missense	probably damaging	1.00
IGL01549:Itgax	APN	7	128131206	splice site	probably null
IGL01864:Itgax	APN	7	128133763	missense	probably benign	0.00
IGL02094:Itgax	APN	7	128131473	missense	probably damaging	1.00
IGL02364:Itgax	APN	7	128139982	missense	possibly damaging	0.89
IGL02969:Itgax	APN	7	128149123	missense	probably benign
IGL03406:Itgax	APN	7	128149198	missense	possibly damaging	0.93
Adendritic	UTSW	7	128148572	nonsense	probably null
PIT4651001:Itgax	UTSW	7	128149110	missense	probably benign	0.11
R0366:Itgax	UTSW	7	128149089	splice site	probably benign
R0763:Itgax	UTSW	7	128147940	splice site	probably benign
R1072:Itgax	UTSW	7	128150144	missense	probably damaging	0.96
R1659:Itgax	UTSW	7	128130891	missense	probably benign	0.15
R2019:Itgax	UTSW	7	128148526	missense	probably benign
R2418:Itgax	UTSW	7	128142333	missense	probably damaging	0.98
R3027:Itgax	UTSW	7	128148572	nonsense	probably null
R3846:Itgax	UTSW	7	128133767	missense	probably damaging	1.00
R3938:Itgax	UTSW	7	128136273	missense	possibly damaging	0.73
R4027:Itgax	UTSW	7	128141266	missense	possibly damaging	0.75
R4163:Itgax	UTSW	7	128144700	missense	probably benign	0.00
R4923:Itgax	UTSW	7	128148528	missense	probably benign
R5259:Itgax	UTSW	7	128148278	missense	probably damaging	0.99
R5333:Itgax	UTSW	7	128142283	missense	probably damaging	1.00
R5347:Itgax	UTSW	7	128141302	missense	probably benign	0.08
R5679:Itgax	UTSW	7	128134990	missense	probably benign	0.00
R5725:Itgax	UTSW	7	128147861	missense	possibly damaging	0.63
R5733:Itgax	UTSW	7	128140475	missense	probably damaging	0.99
R5750:Itgax	UTSW	7	128144706	missense	probably benign	0.32
R5964:Itgax	UTSW	7	128140447	missense	probably damaging	1.00
R6004:Itgax	UTSW	7	128131452	missense	probably damaging	0.96
R6168:Itgax	UTSW	7	128133097	missense	probably damaging	0.99
R6212:Itgax	UTSW	7	128130332	missense	possibly damaging	0.52
R6212:Itgax	UTSW	7	128147853	missense	probably benign	0.16
R6480:Itgax	UTSW	7	128148599	missense	probably benign	0.12
R6484:Itgax	UTSW	7	128133718	missense	probably benign	0.13
R6796:Itgax	UTSW	7	128135064	missense	probably damaging	1.00
R6844:Itgax	UTSW	7	128147934	splice site	probably null
R7287:Itgax	UTSW	7	128148505	missense	probably damaging	1.00
R7365:Itgax	UTSW	7	128135309	missense	probably damaging	1.00
R7421:Itgax	UTSW	7	128140432	missense	probably damaging	1.00
R7599:Itgax	UTSW	7	128148090	missense	probably damaging	0.99
R7710:Itgax	UTSW	7	128135856	missense	probably benign	0.04
R7964:Itgax	UTSW	7	128140418	critical splice acceptor site	probably null
R8220:Itgax	UTSW	7	128130918	missense	probably benign	0.00
R8730:Itgax	UTSW	7	128139894	critical splice acceptor site	probably null
R8742:Itgax	UTSW	7	128144623	missense	probably benign	0.28
R8812:Itgax	UTSW	7	128133807	missense	probably damaging	1.00
R8871:Itgax	UTSW	7	128136051	missense	probably damaging	1.00
R9147:Itgax	UTSW	7	128148741	missense	possibly damaging	0.74
R9149:Itgax	UTSW	7	128131469	missense	probably benign	0.01
R9310:Itgax	UTSW	7	128142260	nonsense	probably null
R9376:Itgax	UTSW	7	128148763	missense	possibly damaging	0.94
R9377:Itgax	UTSW	7	128133677	missense	probably benign	0.03
R9641:Itgax	UTSW	7	128141980	missense	probably damaging	1.00
R9650:Itgax	UTSW	7	128135763	missense	probably benign	0.24
R9709:Itgax	UTSW	7	128136328	missense	probably damaging	1.00
X0061:Itgax	UTSW	7	128129607	start gained	probably benign
Z1176:Itgax	UTSW	7	128144872	missense	probably benign	0.24
Z1177:Itgax	UTSW	7	128148062	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGCCAGGAGATCTTGTGAGTG -3'
(R):5'- ACAGACTTAAAGGGCTTGACG -3'

Sequencing Primer
(F):5'- TGTCCCTTGGAGAATCAGGAC -3'
(R):5'- CTTAAAGGGCTTGACGTGGAG -3'

Posted On

2015-04-30