Incidental Mutation 'R4021:Farsa'
ID 313242
Institutional Source Beutler Lab
Gene Symbol Farsa
Ensembl Gene ENSMUSG00000003808
Gene Name phenylalanyl-tRNA synthetase, alpha subunit
Synonyms Farsla, 0610012A19Rik
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 84856989-84869257 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84868870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 465 (T465A)
Ref Sequence ENSEMBL: ENSMUSP00000003906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003906] [ENSMUST00000003922] [ENSMUST00000109754] [ENSMUST00000136026] [ENSMUST00000156970] [ENSMUST00000170296]
AlphaFold Q8C0C7
Predicted Effect probably damaging
Transcript: ENSMUST00000003906
AA Change: T465A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003906
Gene: ENSMUSG00000003808
AA Change: T465A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:tRNA-synt_2d 209 488 5.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003922
Predicted Effect possibly damaging
Transcript: ENSMUST00000109754
AA Change: T464A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105376
Gene: ENSMUSG00000003808
AA Change: T464A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:tRNA-synt_2b 126 413 2.1e-8 PFAM
Pfam:tRNA-synt_2d 209 487 8.5e-95 PFAM
Pfam:tRNA-synt_2 336 437 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129595
Predicted Effect probably benign
Transcript: ENSMUST00000136026
SMART Domains Protein: ENSMUSP00000122159
Gene: ENSMUSG00000003824

DomainStartEndE-ValueType
coiled coil region 52 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144466
Predicted Effect probably benign
Transcript: ENSMUST00000156970
SMART Domains Protein: ENSMUSP00000120609
Gene: ENSMUSG00000003808

DomainStartEndE-ValueType
Pfam:HTH_11 6 57 3.1e-7 PFAM
low complexity region 70 82 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170296
SMART Domains Protein: ENSMUSP00000131438
Gene: ENSMUSG00000003824

DomainStartEndE-ValueType
coiled coil region 58 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184765
Meta Mutation Damage Score 0.3807 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. This gene encodes a product which is similar to the catalytic subunit of prokaryotic and Saccharomyces cerevisiae phenylalanyl-tRNA synthetases (PheRS). This gene product has been shown to be expressed in a tumor-selective and cell cycle stage- and differentiation-dependent manner, the first member of the tRNA synthetase gene family shown to exhibit this type of regulated expression [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Farsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Farsa APN 8 84864257 missense probably damaging 1.00
IGL02273:Farsa APN 8 84867826 missense probably damaging 1.00
R0006:Farsa UTSW 8 84861305 splice site probably benign
R0599:Farsa UTSW 8 84867583 missense probably damaging 1.00
R0727:Farsa UTSW 8 84861304 splice site probably null
R1933:Farsa UTSW 8 84861151 missense probably benign 0.11
R5127:Farsa UTSW 8 84868964 missense probably benign 0.00
R5975:Farsa UTSW 8 84864432 splice site probably null
R6307:Farsa UTSW 8 84861045 critical splice donor site probably null
R6476:Farsa UTSW 8 84857180 missense probably damaging 0.99
R7226:Farsa UTSW 8 84864060 missense probably benign
R7252:Farsa UTSW 8 84861328 missense probably damaging 1.00
R7593:Farsa UTSW 8 84867649 critical splice donor site probably null
R7773:Farsa UTSW 8 84864152 critical splice donor site probably null
R8033:Farsa UTSW 8 84867569 missense probably benign 0.40
R8235:Farsa UTSW 8 84868916 missense probably damaging 1.00
R8280:Farsa UTSW 8 84861179 missense probably damaging 1.00
R8984:Farsa UTSW 8 84867599 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATCAAGGAAGGCGTCATG -3'
(R):5'- ACAGGGACTAGACAGGGATCTC -3'

Sequencing Primer
(F):5'- CTCTGAGGCTAGATTAAGCATGAAC -3'
(R):5'- ACTAGACAGGGATCTCTGGAAC -3'
Posted On 2015-04-30