Incidental Mutation 'R4021:Farsa'
ID 313242
Institutional Source Beutler Lab
Gene Symbol Farsa
Ensembl Gene ENSMUSG00000003808
Gene Name phenylalanyl-tRNA synthetase, alpha subunit
Synonyms 0610012A19Rik, Farsla
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 85583618-85595886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85595499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 465 (T465A)
Ref Sequence ENSEMBL: ENSMUSP00000003906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003906] [ENSMUST00000003922] [ENSMUST00000109754] [ENSMUST00000136026] [ENSMUST00000156970] [ENSMUST00000170296]
AlphaFold Q8C0C7
Predicted Effect probably damaging
Transcript: ENSMUST00000003906
AA Change: T465A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003906
Gene: ENSMUSG00000003808
AA Change: T465A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:tRNA-synt_2d 209 488 5.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003922
Predicted Effect possibly damaging
Transcript: ENSMUST00000109754
AA Change: T464A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105376
Gene: ENSMUSG00000003808
AA Change: T464A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:tRNA-synt_2b 126 413 2.1e-8 PFAM
Pfam:tRNA-synt_2d 209 487 8.5e-95 PFAM
Pfam:tRNA-synt_2 336 437 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129595
Predicted Effect probably benign
Transcript: ENSMUST00000136026
SMART Domains Protein: ENSMUSP00000122159
Gene: ENSMUSG00000003824

DomainStartEndE-ValueType
coiled coil region 52 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144466
Predicted Effect probably benign
Transcript: ENSMUST00000156970
SMART Domains Protein: ENSMUSP00000120609
Gene: ENSMUSG00000003808

DomainStartEndE-ValueType
Pfam:HTH_11 6 57 3.1e-7 PFAM
low complexity region 70 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184765
Predicted Effect probably benign
Transcript: ENSMUST00000170296
SMART Domains Protein: ENSMUSP00000131438
Gene: ENSMUSG00000003824

DomainStartEndE-ValueType
coiled coil region 58 89 N/A INTRINSIC
Meta Mutation Damage Score 0.3807 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. This gene encodes a product which is similar to the catalytic subunit of prokaryotic and Saccharomyces cerevisiae phenylalanyl-tRNA synthetases (PheRS). This gene product has been shown to be expressed in a tumor-selective and cell cycle stage- and differentiation-dependent manner, the first member of the tRNA synthetase gene family shown to exhibit this type of regulated expression [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam107b G A 2: 3,779,511 (GRCm39) R238Q probably damaging Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Got2 T G 8: 96,604,381 (GRCm39) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Hexd T C 11: 121,108,987 (GRCm39) probably null Het
Igf2r T A 17: 12,967,638 (GRCm39) N27I probably damaging Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lair1 A G 7: 4,058,915 (GRCm39) probably null Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mroh2b T A 15: 4,954,582 (GRCm39) C682S possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Farsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Farsa APN 8 85,590,886 (GRCm39) missense probably damaging 1.00
IGL02273:Farsa APN 8 85,594,455 (GRCm39) missense probably damaging 1.00
R0006:Farsa UTSW 8 85,587,934 (GRCm39) splice site probably benign
R0599:Farsa UTSW 8 85,594,212 (GRCm39) missense probably damaging 1.00
R0727:Farsa UTSW 8 85,587,933 (GRCm39) splice site probably null
R1933:Farsa UTSW 8 85,587,780 (GRCm39) missense probably benign 0.11
R5127:Farsa UTSW 8 85,595,593 (GRCm39) missense probably benign 0.00
R5975:Farsa UTSW 8 85,591,061 (GRCm39) splice site probably null
R6307:Farsa UTSW 8 85,587,674 (GRCm39) critical splice donor site probably null
R6476:Farsa UTSW 8 85,583,809 (GRCm39) missense probably damaging 0.99
R7226:Farsa UTSW 8 85,590,689 (GRCm39) missense probably benign
R7252:Farsa UTSW 8 85,587,957 (GRCm39) missense probably damaging 1.00
R7593:Farsa UTSW 8 85,594,278 (GRCm39) critical splice donor site probably null
R7773:Farsa UTSW 8 85,590,781 (GRCm39) critical splice donor site probably null
R8033:Farsa UTSW 8 85,594,198 (GRCm39) missense probably benign 0.40
R8235:Farsa UTSW 8 85,595,545 (GRCm39) missense probably damaging 1.00
R8280:Farsa UTSW 8 85,587,808 (GRCm39) missense probably damaging 1.00
R8984:Farsa UTSW 8 85,594,228 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATCAAGGAAGGCGTCATG -3'
(R):5'- ACAGGGACTAGACAGGGATCTC -3'

Sequencing Primer
(F):5'- CTCTGAGGCTAGATTAAGCATGAAC -3'
(R):5'- ACTAGACAGGGATCTCTGGAAC -3'
Posted On 2015-04-30