Incidental Mutation 'R4021:Got2'
ID313243
Institutional Source Beutler Lab
Gene Symbol Got2
Ensembl Gene ENSMUSG00000031672
Gene Nameglutamatic-oxaloacetic transaminase 2, mitochondrial
SynonymsFABP-pm, Got-2, plasma membrane fatty acid binding protein, mitochondrial aspartate aminotransferase, mAspAT
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95864134-95888547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 95877753 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 69 (D69A)
Ref Sequence ENSEMBL: ENSMUSP00000034097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034097]
PDB Structure Crystal Structure of Mouse Mitochondrial Aspartate Aminotransferase/Kynurenine Aminotransferase IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase in complex with oxaloacetic acid [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034097
AA Change: D69A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034097
Gene: ENSMUSG00000031672
AA Change: D69A

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:Aminotran_1_2 57 425 4.8e-97 PFAM
Meta Mutation Damage Score 0.8086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Got2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Got2 APN 8 95872201 missense probably benign 0.06
Toothpick UTSW 8 95872268 missense probably benign 0.20
R0189:Got2 UTSW 8 95888253 missense probably benign 0.11
R0254:Got2 UTSW 8 95869538 missense probably benign 0.03
R1450:Got2 UTSW 8 95871986 missense probably benign 0.00
R1552:Got2 UTSW 8 95869494 missense probably benign 0.22
R2495:Got2 UTSW 8 95888290 missense possibly damaging 0.81
R3946:Got2 UTSW 8 95888230 missense probably benign
R4594:Got2 UTSW 8 95872186 missense probably benign 0.15
R5087:Got2 UTSW 8 95872323 missense probably benign 0.00
R5233:Got2 UTSW 8 95875849 missense probably benign 0.33
R6156:Got2 UTSW 8 95872268 missense probably benign 0.20
R6529:Got2 UTSW 8 95888385 start gained probably benign
R8481:Got2 UTSW 8 95888524 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AATCTGCTTTCTCAGGGAAGG -3'
(R):5'- ACATGGATCTTTGGCAGAGCAG -3'

Sequencing Primer
(F):5'- CTGCTTTCTCAGGGAAGGAAAATC -3'
(R):5'- TCTTTGGCAGAGCAGAGACATACC -3'
Posted On2015-04-30