Incidental Mutation 'R4021:Got2'
ID 313243
Institutional Source Beutler Lab
Gene Symbol Got2
Ensembl Gene ENSMUSG00000031672
Gene Name glutamatic-oxaloacetic transaminase 2, mitochondrial
Synonyms plasma membrane fatty acid binding protein, mitochondrial aspartate aminotransferase, FABP-pm, Kyat4, mAspAT
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.616) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 96590761-96615029 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 96604381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 69 (D69A)
Ref Sequence ENSEMBL: ENSMUSP00000034097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034097]
AlphaFold P05202
PDB Structure Crystal Structure of Mouse Mitochondrial Aspartate Aminotransferase/Kynurenine Aminotransferase IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase in complex with oxaloacetic acid [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034097
AA Change: D69A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034097
Gene: ENSMUSG00000031672
AA Change: D69A

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:Aminotran_1_2 57 425 4.8e-97 PFAM
Meta Mutation Damage Score 0.8086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam107b G A 2: 3,779,511 (GRCm39) R238Q probably damaging Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Farsa A G 8: 85,595,499 (GRCm39) T465A probably damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Hexd T C 11: 121,108,987 (GRCm39) probably null Het
Igf2r T A 17: 12,967,638 (GRCm39) N27I probably damaging Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lair1 A G 7: 4,058,915 (GRCm39) probably null Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mroh2b T A 15: 4,954,582 (GRCm39) C682S possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Got2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Got2 APN 8 96,598,829 (GRCm39) missense probably benign 0.06
Toothpick UTSW 8 96,598,896 (GRCm39) missense probably benign 0.20
R0189:Got2 UTSW 8 96,614,881 (GRCm39) missense probably benign 0.11
R0254:Got2 UTSW 8 96,596,166 (GRCm39) missense probably benign 0.03
R1450:Got2 UTSW 8 96,598,614 (GRCm39) missense probably benign 0.00
R1552:Got2 UTSW 8 96,596,122 (GRCm39) missense probably benign 0.22
R2495:Got2 UTSW 8 96,614,918 (GRCm39) missense possibly damaging 0.81
R3946:Got2 UTSW 8 96,614,858 (GRCm39) missense probably benign
R4594:Got2 UTSW 8 96,598,814 (GRCm39) missense probably benign 0.15
R5087:Got2 UTSW 8 96,598,951 (GRCm39) missense probably benign 0.00
R5233:Got2 UTSW 8 96,602,477 (GRCm39) missense probably benign 0.33
R6156:Got2 UTSW 8 96,598,896 (GRCm39) missense probably benign 0.20
R6529:Got2 UTSW 8 96,615,013 (GRCm39) start gained probably benign
R8481:Got2 UTSW 8 96,615,152 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AATCTGCTTTCTCAGGGAAGG -3'
(R):5'- ACATGGATCTTTGGCAGAGCAG -3'

Sequencing Primer
(F):5'- CTGCTTTCTCAGGGAAGGAAAATC -3'
(R):5'- TCTTTGGCAGAGCAGAGACATACC -3'
Posted On 2015-04-30