Mutagenetix > Incidental Mutation

Incidental Mutation 'R4021:Cacna2d2'

313246

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d2

Ensembl Gene

ENSMUSG00000010066

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 2

Synonyms

a2d2

MMRRC Submission

040955-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.830) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107399612-107529343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 107514058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 428 (T428M)

Ref Sequence

ENSEMBL: ENSMUSP00000125943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]

AlphaFold

Q6PHS9

Predicted Effect

probably damaging
Transcript: ENSMUST00000010210
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: T428M

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	9.9e-32	PFAM
Pfam:VGCC_alpha2	583	673	1.8e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1137	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085092
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: T428M

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164988
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: T428M

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	6.7e-49	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	2.4e-31	PFAM
Pfam:VGCC_alpha2	583	675	2.5e-34	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166799
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: T428M

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	8.5e-44	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	576	1.3e-32	PFAM
Pfam:VGCC_alpha2	583	675	1.4e-47	PFAM
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168532
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: T428M

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2.1e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1122	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169354

Predicted Effect

probably damaging
Transcript: ENSMUST00000170737
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: T428M

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	673	1.9e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1116	1139	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171809

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cdh22	T	C	2: 165,143,673	D331G	possibly damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Itgax	T	A	7: 128,133,139		probably null	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lair1	A	G	7: 4,055,916		probably null	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mroh2b	T	A	15: 4,925,100	C682S	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Cacna2d2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Cacna2d2	APN	9	107514873	missense	probably damaging	1.00
IGL00425:Cacna2d2	APN	9	107527351	missense	probably damaging	1.00
IGL01294:Cacna2d2	APN	9	107514081	missense	probably damaging	1.00
IGL01969:Cacna2d2	APN	9	107509216	missense	probably benign
IGL01974:Cacna2d2	APN	9	107517422	missense	probably benign	0.00
IGL02001:Cacna2d2	APN	9	107522116	missense	probably benign
IGL02125:Cacna2d2	APN	9	107513904	nonsense	probably null
IGL02143:Cacna2d2	APN	9	107518275	splice site	probably null
IGL02150:Cacna2d2	APN	9	107527316	splice site	probably benign
IGL02213:Cacna2d2	APN	9	107514048	missense	probably damaging	1.00
IGL02220:Cacna2d2	APN	9	107514879	missense	probably damaging	1.00
IGL02238:Cacna2d2	APN	9	107513558	missense	probably damaging	0.99
IGL02466:Cacna2d2	APN	9	107465554	missense	probably damaging	1.00
IGL02569:Cacna2d2	APN	9	107514046	missense	probably damaging	0.99
IGL02571:Cacna2d2	APN	9	107525646	missense	possibly damaging	0.93
IGL02825:Cacna2d2	APN	9	107524460	missense	probably damaging	1.00
IGL03000:Cacna2d2	APN	9	107524198	splice site	probably null
IGL03064:Cacna2d2	APN	9	107509275	missense	probably damaging	1.00
Blow	UTSW	9	107513606	missense	probably null	0.90
dilemma	UTSW	9	107514864	missense	probably damaging	1.00
hera	UTSW	9	107513280	missense	probably damaging	1.00
Ionian	UTSW	9	107525376	missense	probably benign	0.05
Solomonic	UTSW	9	107524662	missense	possibly damaging	0.94
PIT4131001:Cacna2d2	UTSW	9	107524668	missense	probably damaging	1.00
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0387:Cacna2d2	UTSW	9	107513881	missense	probably damaging	1.00
R0410:Cacna2d2	UTSW	9	107524620	missense	probably damaging	1.00
R0538:Cacna2d2	UTSW	9	107524383	splice site	probably benign
R0545:Cacna2d2	UTSW	9	107525223	missense	probably damaging	1.00
R0729:Cacna2d2	UTSW	9	107517257	missense	probably benign	0.06
R1024:Cacna2d2	UTSW	9	107527050	critical splice donor site	probably null
R1538:Cacna2d2	UTSW	9	107517416	missense	probably damaging	1.00
R1750:Cacna2d2	UTSW	9	107524644	missense	probably damaging	1.00
R1774:Cacna2d2	UTSW	9	107526151	missense	probably benign	0.19
R1800:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.46
R1873:Cacna2d2	UTSW	9	107513872	missense	probably damaging	0.98
R1935:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1936:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1971:Cacna2d2	UTSW	9	107512006	missense	probably damaging	0.98
R2095:Cacna2d2	UTSW	9	107527165	missense	probably benign	0.05
R2135:Cacna2d2	UTSW	9	107526513	missense	possibly damaging	0.74
R2197:Cacna2d2	UTSW	9	107527403	missense	probably damaging	0.97
R2266:Cacna2d2	UTSW	9	107513280	missense	probably damaging	1.00
R2483:Cacna2d2	UTSW	9	107512022	missense	probably damaging	1.00
R4392:Cacna2d2	UTSW	9	107400280	missense	possibly damaging	0.47
R4629:Cacna2d2	UTSW	9	107527322	missense	probably damaging	1.00
R5053:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R5327:Cacna2d2	UTSW	9	107513606	missense	probably null	0.90
R5347:Cacna2d2	UTSW	9	107514114	missense	probably benign
R5719:Cacna2d2	UTSW	9	107524652	missense	probably benign	0.36
R5737:Cacna2d2	UTSW	9	107526747	missense	possibly damaging	0.70
R5739:Cacna2d2	UTSW	9	107512329	missense	probably benign	0.37
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6084:Cacna2d2	UTSW	9	107497521	critical splice donor site	probably null
R6170:Cacna2d2	UTSW	9	107527334	missense	probably damaging	1.00
R6254:Cacna2d2	UTSW	9	107509216	missense	probably benign
R6427:Cacna2d2	UTSW	9	107515442	missense	possibly damaging	0.67
R7652:Cacna2d2	UTSW	9	107524198	splice site	probably null
R7850:Cacna2d2	UTSW	9	107525376	missense	probably benign	0.05
R7936:Cacna2d2	UTSW	9	107524127	missense	probably damaging	1.00
R7978:Cacna2d2	UTSW	9	107518257	missense	probably benign	0.14
R8039:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.92
R8165:Cacna2d2	UTSW	9	107525454	splice site	probably null
R8274:Cacna2d2	UTSW	9	107524662	missense	possibly damaging	0.94
R8286:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R8354:Cacna2d2	UTSW	9	107524135	missense	possibly damaging	0.95
R8464:Cacna2d2	UTSW	9	107512007	missense	probably damaging	0.99
R8479:Cacna2d2	UTSW	9	107526397	critical splice donor site	probably null
R8765:Cacna2d2	UTSW	9	107517159	missense	probably damaging	1.00
R8848:Cacna2d2	UTSW	9	107514656	missense	possibly damaging	0.75
R9037:Cacna2d2	UTSW	9	107509196	missense	probably benign	0.08
R9225:Cacna2d2	UTSW	9	107526204	missense	probably benign	0.10
R9295:Cacna2d2	UTSW	9	107509220	missense	probably benign	0.02
R9372:Cacna2d2	UTSW	9	107517603	missense	probably benign	0.00
R9414:Cacna2d2	UTSW	9	107515196	missense	probably damaging	1.00
R9417:Cacna2d2	UTSW	9	107515490	nonsense	probably null
R9435:Cacna2d2	UTSW	9	107519185	missense	probably benign	0.01
R9584:Cacna2d2	UTSW	9	107400205	missense	probably damaging	0.97
R9642:Cacna2d2	UTSW	9	107515428	missense	possibly damaging	0.94
R9784:Cacna2d2	UTSW	9	107527147	missense	probably benign	0.00
Z1176:Cacna2d2	UTSW	9	107517293	missense	probably damaging	1.00
Z1176:Cacna2d2	UTSW	9	107526102	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- ATCATGATGTTCACGGATGGGG -3'
(R):5'- TGGTCAAGCAAGACAGCCC -3'

Sequencing Primer
(F):5'- GGTGAGGATCGCGTGCAG -3'
(R):5'- CACCGGAAAAAGGGTATGTATG -3'

Posted On

2015-04-30