Incidental Mutation 'R4021:Wdr6'
ID313247
Institutional Source Beutler Lab
Gene Symbol Wdr6
Ensembl Gene ENSMUSG00000066357
Gene NameWD repeat domain 6
Synonyms
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108572311-108578739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108575206 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 493 (W493R)
Ref Sequence ENSEMBL: ENSMUSP00000070927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000193427] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000006853
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068700
AA Change: W493R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357
AA Change: W493R

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Meta Mutation Damage Score 0.9242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. The encoded protein interacts with serine/threonine kinase 11, and is implicated in cell growth arrest. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Wdr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Wdr6 APN 9 108574897 missense possibly damaging 0.77
IGL01757:Wdr6 APN 9 108576228 missense possibly damaging 0.65
IGL02096:Wdr6 APN 9 108576553 missense probably damaging 1.00
IGL02577:Wdr6 APN 9 108575941 missense possibly damaging 0.88
IGL02625:Wdr6 APN 9 108575505 missense probably damaging 1.00
IGL02820:Wdr6 APN 9 108578544 missense probably benign 0.28
IGL03250:Wdr6 APN 9 108573197 missense possibly damaging 0.95
PIT4802001:Wdr6 UTSW 9 108574566 missense probably damaging 1.00
R0038:Wdr6 UTSW 9 108572969 missense probably damaging 1.00
R0153:Wdr6 UTSW 9 108575242 missense probably damaging 1.00
R0378:Wdr6 UTSW 9 108575864 missense probably damaging 1.00
R0420:Wdr6 UTSW 9 108573101 missense probably benign 0.41
R1620:Wdr6 UTSW 9 108574655 missense possibly damaging 0.51
R1753:Wdr6 UTSW 9 108575164 missense probably damaging 0.99
R1844:Wdr6 UTSW 9 108575977 missense probably damaging 1.00
R1881:Wdr6 UTSW 9 108573179 splice site probably null
R1987:Wdr6 UTSW 9 108576534 missense probably damaging 1.00
R2029:Wdr6 UTSW 9 108575355 missense probably damaging 1.00
R2139:Wdr6 UTSW 9 108574123 missense probably benign 0.00
R3900:Wdr6 UTSW 9 108575769 missense probably damaging 1.00
R4909:Wdr6 UTSW 9 108572988 missense probably benign 0.28
R5073:Wdr6 UTSW 9 108574366 missense probably damaging 1.00
R5748:Wdr6 UTSW 9 108575782 missense possibly damaging 0.75
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6254:Wdr6 UTSW 9 108574911 missense probably damaging 1.00
R6724:Wdr6 UTSW 9 108574894 missense probably benign 0.11
R7134:Wdr6 UTSW 9 108573365 missense probably damaging 1.00
R7248:Wdr6 UTSW 9 108576039 missense possibly damaging 0.82
R7296:Wdr6 UTSW 9 108574585 missense probably damaging 1.00
R7388:Wdr6 UTSW 9 108574772 missense probably damaging 1.00
R7443:Wdr6 UTSW 9 108574290 missense probably damaging 1.00
R7467:Wdr6 UTSW 9 108573002 missense probably benign 0.14
R7672:Wdr6 UTSW 9 108573748 missense probably benign 0.06
R7699:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
R7700:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
R8559:Wdr6 UTSW 9 108575394 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGTAGAGACGGGGCCTATTC -3'
(R):5'- TCGAGCAGAAACTGTTCCAG -3'

Sequencing Primer
(F):5'- TGTTGGGACACTCTCAGACC -3'
(R):5'- ACTGTTCCAGGGGAAGGTGC -3'
Posted On2015-04-30