Incidental Mutation 'R4021:Hexd'
ID 313254
Institutional Source Beutler Lab
Gene Symbol Hexd
Ensembl Gene ENSMUSG00000039307
Gene Name hexosaminidase D
Synonyms Hexdc
MMRRC Submission 040955-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R4021 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 121095259-121113481 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121108987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000038709] [ENSMUST00000038831] [ENSMUST00000106115] [ENSMUST00000106117] [ENSMUST00000106117] [ENSMUST00000124768]
AlphaFold Q3U4H6
Predicted Effect probably benign
Transcript: ENSMUST00000038709
SMART Domains Protein: ENSMUSP00000042277
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 187 1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038831
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106115
SMART Domains Protein: ENSMUSP00000101721
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 2 184 3e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124768
SMART Domains Protein: ENSMUSP00000122008
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 22 152 8.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151495
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131009
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,148 (GRCm39) L102P probably benign Het
Adcy4 C T 14: 56,012,635 (GRCm39) probably null Het
Adgrf5 A T 17: 43,741,605 (GRCm39) probably benign Het
Atp11a A G 8: 12,892,938 (GRCm39) K643R probably benign Het
Cacna2d2 C T 9: 107,391,257 (GRCm39) T428M probably damaging Het
Cdh22 T C 2: 164,985,593 (GRCm39) D331G possibly damaging Het
Chmp3 T C 6: 71,551,222 (GRCm39) probably null Het
Csnk2a1 C T 2: 152,100,609 (GRCm39) T127M probably damaging Het
Cyp2c55 T A 19: 39,023,878 (GRCm39) probably null Het
Ddias G T 7: 92,510,686 (GRCm39) D105E possibly damaging Het
Dnajb11 A G 16: 22,688,196 (GRCm39) D238G probably damaging Het
Dock7 T C 4: 98,892,157 (GRCm39) probably null Het
Dock9 T C 14: 121,864,324 (GRCm39) K761E possibly damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fam107b G A 2: 3,779,511 (GRCm39) R238Q probably damaging Het
Fam186a G C 15: 99,839,680 (GRCm39) T2188S possibly damaging Het
Farsa A G 8: 85,595,499 (GRCm39) T465A probably damaging Het
Fibp T C 19: 5,510,762 (GRCm39) probably null Het
Flywch2 G A 17: 23,996,013 (GRCm39) T128I possibly damaging Het
Foxi2 A T 7: 135,012,259 (GRCm39) D49V probably damaging Het
Fstl5 A G 3: 76,536,282 (GRCm39) T31A probably benign Het
Gabbr2 G A 4: 46,846,435 (GRCm39) T158I probably damaging Het
Gbp4 T A 5: 105,268,789 (GRCm39) R455W probably damaging Het
Got2 T G 8: 96,604,381 (GRCm39) D69A probably damaging Het
Gpr63 T C 4: 25,008,470 (GRCm39) F398S possibly damaging Het
Gtf2h4 T C 17: 35,981,556 (GRCm39) M186V probably benign Het
Haus2 A T 2: 120,446,411 (GRCm39) Q111L probably damaging Het
Igf2r T A 17: 12,967,638 (GRCm39) N27I probably damaging Het
Itgax T A 7: 127,732,311 (GRCm39) probably null Het
Krit1 T A 5: 3,882,132 (GRCm39) I596K probably benign Het
Lair1 A G 7: 4,058,915 (GRCm39) probably null Het
Lilra6 G T 7: 3,914,417 (GRCm39) T276K probably benign Het
Mast4 G A 13: 102,875,829 (GRCm39) R1112* probably null Het
Mrgprb1 A T 7: 48,096,871 (GRCm39) I347N possibly damaging Het
Mroh2b T A 15: 4,954,582 (GRCm39) C682S possibly damaging Het
Mtif3 T A 5: 146,892,488 (GRCm39) R249S possibly damaging Het
Mycbp2 C T 14: 103,389,593 (GRCm39) E3406K probably damaging Het
Myo15b A G 11: 115,764,331 (GRCm39) H1315R probably benign Het
Nlrp2 A G 7: 5,328,011 (GRCm39) F681L probably benign Het
Or2ag19 T A 7: 106,444,226 (GRCm39) M136K probably damaging Het
Or5l14 T A 2: 87,793,066 (GRCm39) T57S possibly damaging Het
Pear1 T C 3: 87,663,529 (GRCm39) N390D possibly damaging Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rnf17 C T 14: 56,697,458 (GRCm39) H451Y probably damaging Het
Sag A T 1: 87,749,027 (GRCm39) probably null Het
Septin4 A G 11: 87,458,106 (GRCm39) E160G probably damaging Het
Slc22a2 T C 17: 12,803,376 (GRCm39) L70P probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Spag17 A T 3: 99,956,546 (GRCm39) I881F probably benign Het
Taar7a G T 10: 23,869,284 (GRCm39) N32K probably benign Het
Tbck C A 3: 132,432,895 (GRCm39) T435K probably damaging Het
Tril T G 6: 53,796,004 (GRCm39) D406A probably damaging Het
Tshz2 G A 2: 169,727,782 (GRCm39) D324N probably damaging Het
Vps13d A G 4: 144,801,631 (GRCm39) V2349A possibly damaging Het
Wdr6 A G 9: 108,452,405 (GRCm39) W493R probably damaging Het
Wdr72 G A 9: 74,058,875 (GRCm39) V323I probably benign Het
Zfp488 T A 14: 33,693,110 (GRCm39) M18L probably benign Het
Zic4 A G 9: 91,261,089 (GRCm39) T108A probably benign Het
Znrf3 T C 11: 5,231,278 (GRCm39) D745G possibly damaging Het
Other mutations in Hexd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Hexd APN 11 121,111,986 (GRCm39) missense probably benign 0.35
IGL01981:Hexd APN 11 121,107,819 (GRCm39) missense possibly damaging 0.93
R0360:Hexd UTSW 11 121,102,969 (GRCm39) missense probably benign 0.18
R0364:Hexd UTSW 11 121,102,969 (GRCm39) missense probably benign 0.18
R0376:Hexd UTSW 11 121,108,991 (GRCm39) splice site probably benign
R1148:Hexd UTSW 11 121,112,093 (GRCm39) missense probably benign 0.09
R1148:Hexd UTSW 11 121,112,093 (GRCm39) missense probably benign 0.09
R1493:Hexd UTSW 11 121,112,093 (GRCm39) missense probably benign 0.09
R1883:Hexd UTSW 11 121,098,524 (GRCm39) missense probably benign 0.00
R4163:Hexd UTSW 11 121,111,975 (GRCm39) missense probably benign 0.01
R4939:Hexd UTSW 11 121,098,542 (GRCm39) missense probably benign
R5308:Hexd UTSW 11 121,113,095 (GRCm39) missense probably damaging 1.00
R5716:Hexd UTSW 11 121,112,388 (GRCm39) missense probably benign 0.03
R6127:Hexd UTSW 11 121,107,825 (GRCm39) missense possibly damaging 0.89
R6154:Hexd UTSW 11 121,112,097 (GRCm39) missense probably benign 0.02
R6921:Hexd UTSW 11 121,113,107 (GRCm39) missense probably damaging 0.98
R6928:Hexd UTSW 11 121,102,880 (GRCm39) missense possibly damaging 0.82
R6939:Hexd UTSW 11 121,113,164 (GRCm39) missense probably benign 0.09
R7125:Hexd UTSW 11 121,095,496 (GRCm39) unclassified probably benign
R7522:Hexd UTSW 11 121,108,923 (GRCm39) missense possibly damaging 0.61
R8989:Hexd UTSW 11 121,109,136 (GRCm39) intron probably benign
R9694:Hexd UTSW 11 121,107,813 (GRCm39) missense probably damaging 1.00
Z1176:Hexd UTSW 11 121,106,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTAGACCTGATGAGATGGTTC -3'
(R):5'- AAGGACCTGGGATGATCTGG -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
(R):5'- GGGATTCCATGCCAGGACAG -3'
Posted On 2015-04-30