Mutagenetix > Incidental Mutation

Incidental Mutation 'R4021:Mast4'

313255

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

040955-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Essential gene?

Possibly non essential (E-score: 0.398) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 102739321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1112 (R1112*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

AlphaFold

Q811L6

Predicted Effect

probably null
Transcript: ENSMUST00000099202
AA Change: R1103*

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: R1103*

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000167058
AA Change: R1280*

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: R1280*

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000171791
AA Change: R1088*

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: R1088*

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

probably null
Transcript: ENSMUST00000194446
AA Change: R1112*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adcy4	C	T	14: 55,775,178		probably null	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cacna2d2	C	T	9: 107,514,058	T428M	probably damaging	Het
Cdh22	T	C	2: 165,143,673	D331G	possibly damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Itgax	T	A	7: 128,133,139		probably null	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lair1	A	G	7: 4,055,916		probably null	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mroh2b	T	A	15: 4,925,100	C682S	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
skinnybones	UTSW	13	102804641	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	102953125	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102735739	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102738721	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102751478	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102761392	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102783391	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102758666	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102798098	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102781245	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103333930	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102751425	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102789024	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102736436	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102737085	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102774203	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102754197	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102754197	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCATGTGTGATTCAGCCTG -3'
(R):5'- GTCAGCACAGAAGTGGCATG -3'

Sequencing Primer
(F):5'- GTGATTCAGCCTGTTTTCCTAAG -3'
(R):5'- CACAGAAGTGGCATGCTACCATTTAG -3'

Posted On

2015-04-30