Mutagenetix > Incidental Mutation

Incidental Mutation 'R4021:Adcy4'

313258

Institutional Source

Beutler Lab

Gene Symbol

Adcy4

Ensembl Gene

ENSMUSG00000022220

Gene Name

adenylate cyclase 4

Synonyms

MMRRC Submission

040955-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4021 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55769057-55784095 bp(-) (GRCm38)

Type of Mutation

splice site (37 bp from exon)

DNA Base Change (assembly)

C to T at 55775178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000170223]

AlphaFold

Q91WF3

Predicted Effect

probably null
Transcript: ENSMUST00000002398

SMART Domains

Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220

Domain	Start	End	E-Value	Type
low complexity region	28	48	N/A	INTRINSIC
low complexity region	66	80	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
CYCc	218	426	1.56e-62	SMART
Pfam:DUF1053	479	581	2.4e-35	PFAM
transmembrane domain	607	629	N/A	INTRINSIC
transmembrane domain	661	683	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	746	768	N/A	INTRINSIC
transmembrane domain	792	809	N/A	INTRINSIC
CYCc	835	1057	4.46e-40	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000170223

SMART Domains

Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC
transmembrane domain	61	80	N/A	INTRINSIC
transmembrane domain	92	114	N/A	INTRINSIC
transmembrane domain	119	138	N/A	INTRINSIC
transmembrane domain	145	162	N/A	INTRINSIC
transmembrane domain	172	194	N/A	INTRINSIC
CYCc	218	426	1.56e-62	SMART
Pfam:DUF1053	479	581	1.6e-24	PFAM
transmembrane domain	607	629	N/A	INTRINSIC
transmembrane domain	661	683	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	746	768	N/A	INTRINSIC
transmembrane domain	792	809	N/A	INTRINSIC
CYCc	835	1057	4.46e-40	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226361

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228933

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,088	L102P	probably benign	Het
Adgrf5	A	T	17: 43,430,714		probably benign	Het
Atp11a	A	G	8: 12,842,938	K643R	probably benign	Het
Cacna2d2	C	T	9: 107,514,058	T428M	probably damaging	Het
Cdh22	T	C	2: 165,143,673	D331G	possibly damaging	Het
Chmp3	T	C	6: 71,574,238		probably null	Het
Csnk2a1	C	T	2: 152,258,689	T127M	probably damaging	Het
Cyp2c55	T	A	19: 39,035,434		probably null	Het
Ddias	G	T	7: 92,861,478	D105E	possibly damaging	Het
Dnajb11	A	G	16: 22,869,446	D238G	probably damaging	Het
Dock7	T	C	4: 99,003,920		probably null	Het
Dock9	T	C	14: 121,626,912	K761E	possibly damaging	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Fam107b	G	A	2: 3,778,474	R238Q	probably damaging	Het
Fam186a	G	C	15: 99,941,799	T2188S	possibly damaging	Het
Farsa	A	G	8: 84,868,870	T465A	probably damaging	Het
Fibp	T	C	19: 5,460,734		probably null	Het
Flywch2	G	A	17: 23,777,039	T128I	possibly damaging	Het
Foxi2	A	T	7: 135,410,530	D49V	probably damaging	Het
Fstl5	A	G	3: 76,628,975	T31A	probably benign	Het
Gabbr2	G	A	4: 46,846,435	T158I	probably damaging	Het
Gbp4	T	A	5: 105,120,923	R455W	probably damaging	Het
Gm11492	A	G	11: 87,567,280	E160G	probably damaging	Het
Got2	T	G	8: 95,877,753	D69A	probably damaging	Het
Gpr63	T	C	4: 25,008,470	F398S	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,664	M186V	probably benign	Het
Haus2	A	T	2: 120,615,930	Q111L	probably damaging	Het
Hexdc	T	C	11: 121,218,161		probably null	Het
Igf2r	T	A	17: 12,748,751	N27I	probably damaging	Het
Itgax	T	A	7: 128,133,139		probably null	Het
Krit1	T	A	5: 3,832,132	I596K	probably benign	Het
Lair1	A	G	7: 4,055,916		probably null	Het
Lilra6	G	T	7: 3,911,418	T276K	probably benign	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrgprb1	A	T	7: 48,447,123	I347N	possibly damaging	Het
Mroh2b	T	A	15: 4,925,100	C682S	possibly damaging	Het
Mtif3	T	A	5: 146,955,678	R249S	possibly damaging	Het
Mycbp2	C	T	14: 103,152,157	E3406K	probably damaging	Het
Myo15b	A	G	11: 115,873,505	H1315R	probably benign	Het
Nlrp2	A	G	7: 5,325,012	F681L	probably benign	Het
Olfr1157	T	A	2: 87,962,722	T57S	possibly damaging	Het
Olfr703	T	A	7: 106,845,019	M136K	probably damaging	Het
Pear1	T	C	3: 87,756,222	N390D	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rnf17	C	T	14: 56,460,001	H451Y	probably damaging	Het
Sag	A	T	1: 87,821,305		probably null	Het
Slc22a2	T	C	17: 12,584,489	L70P	probably damaging	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Spag17	A	T	3: 100,049,230	I881F	probably benign	Het
Taar7a	G	T	10: 23,993,386	N32K	probably benign	Het
Tbck	C	A	3: 132,727,134	T435K	probably damaging	Het
Tril	T	G	6: 53,819,019	D406A	probably damaging	Het
Tshz2	G	A	2: 169,885,862	D324N	probably damaging	Het
Vps13d	A	G	4: 145,075,061	V2349A	possibly damaging	Het
Wdr6	A	G	9: 108,575,206	W493R	probably damaging	Het
Wdr72	G	A	9: 74,151,593	V323I	probably benign	Het
Zfp488	T	A	14: 33,971,153	M18L	probably benign	Het
Zic4	A	G	9: 91,379,036	T108A	probably benign	Het
Znrf3	T	C	11: 5,281,278	D745G	possibly damaging	Het

Other mutations in Adcy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Adcy4	APN	14	55773663	splice site	probably null
IGL02406:Adcy4	APN	14	55770047	missense	possibly damaging	0.45
IGL02503:Adcy4	APN	14	55771505	missense	probably damaging	1.00
IGL02543:Adcy4	APN	14	55769170	missense	probably benign
IGL02616:Adcy4	APN	14	55783514	splice site	probably null
IGL03002:Adcy4	APN	14	55773556	missense	probably benign	0.31
IGL03026:Adcy4	APN	14	55778010	missense	probably damaging	1.00
IGL03190:Adcy4	APN	14	55779053	missense	probably damaging	1.00
IGL03247:Adcy4	APN	14	55770096	missense	probably damaging	1.00
stressed	UTSW	14	55779099	splice site	probably null
IGL03098:Adcy4	UTSW	14	55781581	missense	probably null	0.82
R0098:Adcy4	UTSW	14	55769827	missense	possibly damaging	0.78
R0102:Adcy4	UTSW	14	55771533	missense	probably benign	0.29
R0396:Adcy4	UTSW	14	55772288	missense	probably benign	0.00
R0482:Adcy4	UTSW	14	55774572	critical splice acceptor site	probably null
R0634:Adcy4	UTSW	14	55781597	missense	probably benign
R0691:Adcy4	UTSW	14	55772647	splice site	probably benign
R0704:Adcy4	UTSW	14	55772756	missense	probably benign
R0815:Adcy4	UTSW	14	55783599	missense	probably damaging	1.00
R0863:Adcy4	UTSW	14	55783599	missense	probably damaging	1.00
R1446:Adcy4	UTSW	14	55770023	critical splice donor site	probably null
R1462:Adcy4	UTSW	14	55778308	missense	possibly damaging	0.78
R1462:Adcy4	UTSW	14	55778308	missense	possibly damaging	0.78
R1463:Adcy4	UTSW	14	55778939	missense	probably damaging	1.00
R1624:Adcy4	UTSW	14	55781927	missense	possibly damaging	0.68
R1799:Adcy4	UTSW	14	55771472	missense	probably benign	0.01
R1878:Adcy4	UTSW	14	55769905	missense	probably damaging	0.96
R2007:Adcy4	UTSW	14	55778313	missense	possibly damaging	0.45
R2156:Adcy4	UTSW	14	55769170	missense	probably benign	0.09
R2425:Adcy4	UTSW	14	55778017	missense	probably damaging	0.99
R2517:Adcy4	UTSW	14	55781946	missense	probably damaging	1.00
R3882:Adcy4	UTSW	14	55774546	missense	probably benign	0.27
R4022:Adcy4	UTSW	14	55775178	splice site	probably null
R4411:Adcy4	UTSW	14	55769443	missense	probably damaging	1.00
R4530:Adcy4	UTSW	14	55779028	missense	probably damaging	1.00
R4560:Adcy4	UTSW	14	55778950	splice site	probably null
R4704:Adcy4	UTSW	14	55775025	missense	possibly damaging	0.91
R4780:Adcy4	UTSW	14	55775036	missense	probably benign	0.07
R4860:Adcy4	UTSW	14	55781927	missense	possibly damaging	0.68
R4860:Adcy4	UTSW	14	55781927	missense	possibly damaging	0.68
R4868:Adcy4	UTSW	14	55773722	missense	probably benign
R4890:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4920:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4948:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4952:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4953:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4987:Adcy4	UTSW	14	55773477	missense	probably benign	0.01
R4991:Adcy4	UTSW	14	55773465	missense	probably benign	0.03
R5080:Adcy4	UTSW	14	55772375	missense	probably damaging	0.98
R5620:Adcy4	UTSW	14	55772367	nonsense	probably null
R5652:Adcy4	UTSW	14	55773443	missense	probably benign
R5726:Adcy4	UTSW	14	55783661	missense	probably damaging	1.00
R5910:Adcy4	UTSW	14	55779013	missense	probably damaging	1.00
R5958:Adcy4	UTSW	14	55779099	splice site	probably null
R6280:Adcy4	UTSW	14	55779043	missense	probably damaging	1.00
R6318:Adcy4	UTSW	14	55769224	missense	probably damaging	1.00
R6598:Adcy4	UTSW	14	55770045	missense	probably benign	0.03
R6947:Adcy4	UTSW	14	55778391	missense	possibly damaging	0.92
R7012:Adcy4	UTSW	14	55779919	missense	possibly damaging	0.95
R7147:Adcy4	UTSW	14	55779725	missense	probably damaging	1.00
R7386:Adcy4	UTSW	14	55778327	missense	probably damaging	1.00
R7414:Adcy4	UTSW	14	55781633	missense	probably benign	0.15
R7431:Adcy4	UTSW	14	55772672	missense	probably benign	0.01
R7490:Adcy4	UTSW	14	55770433	missense	possibly damaging	0.66
R7552:Adcy4	UTSW	14	55773465	missense	probably benign	0.00
R7672:Adcy4	UTSW	14	55780905	missense	probably benign	0.14
R8003:Adcy4	UTSW	14	55781635	missense	probably benign	0.00
R8042:Adcy4	UTSW	14	55775239	missense	probably benign	0.01
R8100:Adcy4	UTSW	14	55772265	nonsense	probably null
R8343:Adcy4	UTSW	14	55775240	missense	probably benign	0.02
R8801:Adcy4	UTSW	14	55771995	missense	probably benign	0.05
R8811:Adcy4	UTSW	14	55772764	missense	probably benign
R8993:Adcy4	UTSW	14	55771378	missense	probably null	1.00
R8993:Adcy4	UTSW	14	55778699	missense	probably damaging	1.00
R9026:Adcy4	UTSW	14	55778969	missense	probably damaging	1.00
X0025:Adcy4	UTSW	14	55770391	missense	probably damaging	1.00
Z1088:Adcy4	UTSW	14	55780956	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CAGGAGGTTGAAGTCCTTCG -3'
(R):5'- CCTCATCTTTGACAGTGGGG -3'

Sequencing Primer
(F):5'- GACTGCTTCCACTGTCTGGTG -3'
(R):5'- CCCTAGAGGACTGCTTTGC -3'

Posted On

2015-04-30